Iranian Food Science and Technology Research Journal

Abstract Introduction: Bread stales and unfortunately it is a certainty and causes significant product waste all over the world.Staling results in loss of important sensory parameters of bread, like flavor and texture, and it is a consequence of a group of several physical–chemical changes occurring during bread storage that lead mainly to an increase of crumb firmness and loss of freshness (Gray and Bemiller 2003). At 21th century freezing technology introduced to bakery industry in order to increase bread shelf life, access fresh bread with a minimum need for equipment and skilled personal at any time.The current trend in the baking industry is to use frozen dough to manufacture quality products because it can be quickly transformed into fresh baked product. However, the use of frozen dough has certain disadvantages such as its variable performance and loss of stability over long-term frozen storage (Ribotta and Le Bail 2007). Research has shown that ice crystallization and recrystallization causes physical damage to the gluten network, leading to changes in the rheological properties of the frozen dough. Water available for freezing forms ice crystals that injure yeast cells (Mazur 1968). Gums trap free water and control moisture migration.Furthermore, Ward and Andon (1993) mentioned that gums such as carboxymethyl cellulose, carrageenan, gum arabic, and locust bean gum may be used to alleviate the problems associated with frozen dough. Numerous studies report that enzymes play key roles in bread making such as increasing loaf volume, producing finer crumb cells, and extending shelf-life. Amylase improved frozen dough bread quality; the enzyme allowed us to obtain breads from frozen dough with high specific volume and low crumb firmness(Ribotta and Le Bail 2007). Therefore, the aim of this work was to study the effect of guar gum and alpha amylase on frozen dough and the influence of them on the minimization of the damage caused by frozen storage.
Materials and methods: Wheat flour sample (cvs, Pishgam) with 10.52% moisture, 10.8% proteins ,79% ash, 26.7% wet gluten, was obtained from silo No.3, Mashhad, Iran. Bread recipes also contained active dry yeast (Razavi Co., Mashhad, Iran), vegetable oil( Ladan Co. Behshahr, Iran), salt and sugar (Local market). Amylase enzyme (25 klu/g) and guar gum afforded from Novozyme and Rodhia CO respectively. The bread formula used for Barbari bread consisted of flour (100 parts), compressed yeast (2 parts), salts (2 parts), sugars (1parts), vegetable oil (1 part) and water (based on water absorption at 500 BU). Guar and amylase replaced in bread formulation at two levels (0.4 and 0.8%), and (0.05. 0.07 %) respectively. Bread was part baked in an electric oven with an incorporated proofing chamber (Zuccihelli, forni, Hal, Italy) at 210˚C for 7 min to obtain texture structure before starting coloring reaction. Barbari bread sample were packaged in polyethylene bags and frozen in a blast freezer. After storage at -18°C for 15 day, PBF bread was thawed at room temperature for 10 min and rebaked at 260°C for 8 min. The fresh bread baked at 230 °C for 15 mines (Ba´rcenas and Rosell, 2007). Specific volume , porosity, texture evaluation, image analysis (L*a*b*) and sensory evaluation of bread were measured using AACC methods (2000). Results were reported as the average of three replications (all treatments were evaluated in three batches). The data obtained were statistically treated by a complete randomized design (factorial) analysis while the means were compared by the Duncan’s test at a significance level of 5%, in both cases using SPSS statistical software (version 17).
Result and discussion: The results showed that frozen storage had significant effects on the specific volume, moisture content, crumb hardness, sensory properties and bread color. Addition of gum and enzyme to bread recipe improved bread quality, alone and in combination. The presence of guar and amylase removing the negative effects of process conditions. Addition of guar at 0.4% improved specific volume, textural properties, color, sensory score and decrease bread firmness. Also using of amylase in 0.07%,increased bread quality. When guar used in combination with amylase, the synergistic effect was observed. The best result, obtained with 0.4% guar and 0.07% amylase.
Conclution: In summary, the result of this study has shown that textural and sensory properties of part baked frozen bread were poor. Addition of guar gum increased specific volume and sensory score of bread. Guar in 0.4% concentration in comination with amylase in 0.07%, were more effective and it could introduce as a improver for part baked frozen bread.

Abstract Introduction: The term antioxidant is said to be compounds that are delaying or preventing oxidization of a substance at their own presence, which leads to reach a stabilized food quality (Collins, 2005). Natural antioxidants are often phenolic compounds that exist in all parts of a plant. These compounds are secondary metabolites that can inhibit active oxygen species by giving hydrogen atoms and converting them into more stable non-radical compounds due to oxidation and reduction properties. They also have the ability to chelate the metals (Wijngaard et al., 2009 and Erasto et al., 2007). Regarding the positive effects of natural antioxidants, many studies have been conducted to extract, identify and apply them from various herbal sources. Edible fruit jujube is a member of the Ramanaceae family, known in Iran as the jujube. The plants of the family are jujube flowers, which are all diploid and have 24 chromosomes. The jujube tree has been cultivated in China for thousands of years ago and is used as a medicine, food and food flavoring, also distributed in tropical and subtropical regions of Europe, Australia and South Asia. (Su et. al., 2005, Yan et. al., 2002, Preeti et al. 2014). Phenolic compounds have a high potential for antioxidants and a natural source of antioxidants. The antioxidant capacity of the Jujube is due to its antioxidant compounds such as flavonoids, total phenolic, anthocyanins and ascorbic acid. Zhao et al., 2014) and Zhang et al., 2010). Shell, pulp and fruit jujube seeds have a wide range of phenolic compounds and have long been used as a drug and flavor agent (Zhang et. al., 2010, Mahajan et al., 2009). Many studies have investigated the effects of Jujube fruit and its juice on the prevention and treatment of diseases such as digestive disorders, weakness, obesity, liver problems, diabetes, skin infections, Infections, Anemia, and Allergies have been reported (Gao et al., 2015 and 2013, Kim et al., 2011, Verma, 2016, Li et al., 2012). In a study by Wang et al. on Jujube fruit, 22 compounds were identified in ethanol jujube extracts (Wang et al., 2014). Zhang et al. The study that they carried out showed that the antioxidant activity of the jujube is due to its antioxidant compounds, such as flavonoids, total phenolic, anthocyanidins and ascorbic acid (Zhang et al., 2010). Italian scientists influence the phenolic compounds of jujube fruit extract on breast cancer cells (Plastina et al., 2012). During a study conducted in Egypt, the effect of jujube fruit on obesity, lipid profile and liver function were examined. (Mostafa et al., 2013). In another study on juvenile fruit phenolic compounds, the effect of jujube on seizure treatment was evaluated and the results showed that jujube has protective properties against seizure, oxidative stress and other disorders. Pahuja et al., 2011).
In this research, extraction of phenolic compounds of Ziziphus Jujuba extracts has been performed using the supercritical carbon dioxide fluid method and optimization of the extracted compounds and the measurement of the antioxidant activity of Jujube fruit.
 
Materials and methods: Jujube fruit was prepared from Birjand in late August. Chemical materials such as pure ethanol, reagent Folin-Cictalto, sodium carbonate and free radical molecules from German-German corporations and Sigma Aldrich, and laboratory glassware and instruments such as volumetric balloons, refrigerators and freezers, spatula, vertex, buret, pipettes, calibrated cylinders, Filter paper, Falcon, Human Dimension, Mesh 30, Funnel and Arlene were provided. The freshly purchased fruits were separated from the tree before drying. After separating the jujube grain, the fruit was dried at 40°C in a digital-powered oven (volume 5 liters made by Binder Company in Germany), and dried with the aid of a home-made mill. For particles of uniform size, the resulting powder was sown using a mesh 30 and kept in a refrigerator at -20°C until it was extracted.
 
Results & discussion: Generally, according to the results of both solvent extraction and supercritical fluid extraction (SFE) methods, the total amount of phenolic extraction at the optimal point in terms of mg Gallic acid to gram of dry extract in the solvent extraction and in the supercritical method were 26.21 and 2.24, respectively. Comparison of the obtained values ​​at the optimal point of both methods indicated that the solvent method shows higher values of the total phenol content and it has been more successful. However, due to the insignificant differences in total extraction phenol content between the two methods, the supercritical method can be described as a better way to extract phenolic compounds, since the supercritical method was less effective than antioxidant power despite the presence of phenol,  because in the supercritical method, the selectivity can be increased and the target compounds can be isolated by adjusting the temperature and pressure which increases the purity and increase the antioxidant property, and the purpose of the extraction of phenolic compounds. On the other hand, due to the low amount of organic solvent used in this method and the reduction of health and environmental risks, the supercritical method can be introduced as an effective method for extraction of phenolic compounds from Ziziphus Jujube fruit, which reduces the consumption of organic solvent and causes in an efficiency equal with solvent method approximately. In general, according to the amount of total phenolic extraction in both methods, it can be said that Jujube has higher phenol content than other herbs and it can be introduced as a natural antioxidant at the commercial level.

Abstract Introduction
 Ultrafiltration is one of the most common membrane processes in the dairy industry, especially for condensing and separating milk components. Using this process, several products can be produced, including milk concentrate used for cheese production, low-lactose dairy products, milk protein concentrate, and serum proteins for dietary supplements. The efficiency and cost of a membrane process depend on the percentage of rejection of the soluble components. Therefore, the use of concentrated milk made by ultrafiltration in the production of various dairy products depends on the efficiency of the membrane process and the changes in milk components during this process. On the one hand, the physicochemical properties of camel milk are different from those of cow milk, especially in terms of type and amount of protein. Because significant differences exist between the physicochemical properties of camel and cow milk, likely, the membrane processing conditions and the physicochemical properties of their products will be different completely. Although many studies have been conducted on the efficacy of the ultrafiltration processing of cow milk, there is no information about the efficacy of camel milk ultrafiltration, and most of the research done regarding optimizing is based on classical algorithms, Therefore, in this study, the effects of transmembrane pressure and temperature on the solutes rejection (protein, lactose, ash, and total solids) during camel milk ultrafiltration process were investigated, Then, these properties were optimized using particle swarm algorithm. Also, because the performance of the particle swarm algorithm is highly dependent on related parameters such as the number of iterations, the number of particles, accelerate constant, inertia weight, and velocity of the particles, so before optimization, the effect of these parameters on optimal responses were examined by partial least squares regression (PLS).
 
Materials and Methods
 In this study, a pilot crossflow ultrafiltration system was used. A UF membrane (Model 3838 HFK-131, Koch membrane systems, Inc., USA) made of polysulfone amid (PSA) with MWCO of 20 kDa was applied. Camel milk was purchased from a local market in Mashhad and for camel skim milk production, its fat was separated by a pilot plant milk fat separator in the Food Research Complex, Ferdowsi University of Mashhad. The weight percentages of protein, fat, lactose, ash, and total solids of UF permeate samples were measured by ISO 8968-1:2014, ISO 1211: 2010, ISO 26462/IDF 214:2010, ISO 5544:2008, and ISO 6731:2010 at two replications, respectively. the process treatments were performed in the form of a central composite design (CCD) (5 replications at the central point) for two independent variables at three levels so that the total number of 13 treatments was obtained. The data were modeled using the statistical software of Design Expert (version 11) based on the response surface methodology and each of the response variables in the form of a regression model was presented as a function of independent variables.
 
Results and Discussion
 The rejection of total solids and protein of the tested samples varied in the range of 45.4-51.03% and 94.09-97.51%, respectively. It means that in each TMP and T, more than 45% of the total solids and 94% of the protein of camel milk were kept by the membrane. The results also showed that none of the linear, quadratic and interactive effects of TMP and T on the total solids and protein rejections were not significant. According to the results, the R_L reduced with increasing T. Increasing the TMP also led to a reduction at high T and an increase in R_L rate of the samples at lover T. Also, the effect of TMP on R_A showed a non-linear trend, so that TMP at high T led to an increase, and at low T, it led to a reduction in the R_A of the samples.
 
Conclusion
 The optimization results with the particle swarm algorithm showed that this algorithm has a high convergence speed and by recognizing and analyzing its parameters, the optimal conditions can be easily found. The optimum ultrafiltration conditions in this study with the lowest R_L and R_A were determined as 80 kPa TMP and 29.85 ͦ C T.

Abstract Introduction: Roasting is one of the most important thermal processing to improve the physicochemical and organoleptic properties of nuts. Wild almond, especially roasted wild almond is very sensitive to oxidation due to its high content of unsaturated fatty acids. Lipid oxidation can be inhibited by using a suitable packaging material and modifying the atmosphere of the packaging. In this research, the effects of roasting degree (light roasting at 50°C/60 min, medium roasting at 100°C/45 min and dark roasting at 200°C/ 30 min), as well as the presence/ absence of nitrogen gas in two types of pouches including polyethylene (PE) and oriented polypropylene/ cast polypropylene (OPP/CPP) were investigated. The effects of above mentioned treatments were examined using Completely Randomized Design on the moisture, total fat, firmness, peroxide value and conjugated trienes, fatty acid profile and sensory properties during two months storage at 37°C.
 
Materials and Methods: The wild almonds used in this research were collected randomly from the Dasht-e-Arjan region in Fars province (Iran). The debittering process of almonds was done by soaking in 4- 6 % (w/v) of NaCl solution for 12 hours at three consecutive days. A certain amount of debittered wild almonds with a uniform size were roasted at 50°C for 60 minutes (light- roasting), 100°C for 45 minutes (medium- roasting) and 200°C for 30 minutes (dark- roasting) in a laboratory toaster (SSN-2004x, Iran). After cooling at room temperature, samples of 100 g were packed using gas flushing packing machine (90SM4, Shadmehr Co., Iran) in three different conditions: a) air atmosphere (in transparent PE pouches, 70- 75 mm thickness), b) modified atmosphere flushed with N₂ gas (in transparent PE pouches, 70- 75 mm thickness), c) modified atmosphere flushed with N₂ gas (in two-layer transparent OPP-CPP pouches, 25 and 50 mm thickness of the first and second layer). The samples were stored for two months at 37°C and 7-8% R.H. At definite time intervals, the samples were analyzed for the moisture content by oven drying, total oil content by the soxhlet method, protein content by the Kjeldahl method, and fiber content through chemical gravimetric method. Extraction of oil from the nut samples was carried out using hexane, as described by Kornsteiner et al. (2009). Peroxide value (PV) was determined by the iodometric assay according to IUPAC standard method 2.501. Conjugated trienes were calculated according to IUPAC Official Method 2.205 based on measuring absorbance of a solution containing 0.01-0.03 g of oil in 25 ml of isooctane. The fatty acid composition of wild almond oils was determined by gas chromatography equipped with flame ionization detection. Hardness of the wild almond was evaluated using a Texture Analyzer (CT3-Brookfield, USA). Sensory evaluation of samples was carried out by 30 trained panelists using a five point hedonic scale. Statistical analysis of completely randomized design with three replications and means comparison in 95% confidence level was employed using the SPSS-19 software.
 
Results and Discussion: Analysis of variance indicated that the independent effects of roasting conditions, packaging and storage time and the interaction of roasting conditions and storage time on the mentioned parameters were significant (p<0.01). With roasting at higher temperatures, the moisture content and hardness decreased significantly while the oil, protein and fiber content of wild almond kernels and the peroxide value (PV) and conjugated trienes (CT) of their oils increased significantly. However, the increase in protein and CT for medium and low roasting conditions and the increase in fiber for medium and high roasting conditions were not significant (p>0.05). Moreover, increasing the roasting temperature of wild almond led to a significant increase of palmitic acid and a significant decrease of stearic acid whereas other fatty acids did not change significantly. There was a remarkable increase and then a rapid decrease in the fiber, fat and protein content of all roasted samples during the first and second months of storage, respectively. Whereas the PV and CT of oils increased and the moisture content and hardness decreased significantly during the two- months storage. For each roasting temperature, wild almonds packaged in pouches under N₂ had lower PV and CT of oils and the OPP/CPP pouches under N₂ had better performance in this regard and retaining moisture, fat, protein, fiber content and texture. At the end of storage with PV of 24.6 (meqO₂/kg oil) and K268 of 1.92 the dark-roasted almond sample packaged with PE/air atmosphere was the least stable, and the light-roasted sample packaged with OPP/CPP under N₂ with PV of 5.3 (meqO₂/kg oil) and K268 of 1.57 was the most stable form against oxidation. According to the results of sensory analysis, the highest overall acceptability score was attributed to the samples roasted at 100°C for 45 minutes.

Abstract Introduction: Nowadays, More people are interested in consuming organic products. Many of the organic foods and dairy products are produced by rural people and nomads in Iran. Some people are concerned about using of the contaminated organic foods with pathogenic microorganisms, because some of these organic foods are produced under poor hygienic conditions. On the other hand, many native strains of probiotic bacteria especially lactic acid bacteria can be found in these organic foods. In this study, the microbial community and sanitary quality of ewe’s drinking yogurt produced by Somar region nomads, by using culture dependent molecular method and next-generation sequencing (NGS), as a new tool for the culture independent molecular characterization of bacteria, were assessed. Materials and methods: A total of three Ewe's drinking yogurt samples were collected from the nomads of Somar region in Iran under sterile conditions. For phenotypic identification of lactic acid bacteria, a volume of 0.1 milliliters of appropriate dilutions was cultured on MRS agar and M17 agar media. The plates were incubated at 37oC under anaerobic condition with Anaerocult® A for 48 hours. Typical LAB characteristics colonies were purified by streaking method on MRS agar and M17 agar. The catalase negative and Gram positive isolates were selected as presumptive lactic acid bacteria for phenotypic identification to the genus level. These isolated bacteria were tested for growth at 100C and 450C in MRS and M17 broth, gas production from glucose, growth in the presence of 6.5% and 18% of NaCl, growth at pH 4.4 and pH 9.6 and arginine hydrolysis. Isolates were identified by amplification of the 16S ribosomal RNA gene by Polymerase Chain Reaction and ribosomal DNA sequencing as a culture dependent molecular method. After DNA extraction of isolates, PCR was performed using prokaryotic 16S rDNA universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3). In the next step, the culture-independent molecular method based on next-generation sequencing of 16S ribosomal RNA gene amplicons was applied. The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locus‐specific sequences were: Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐ [locus- specific sequence] Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed. The fastq files from the next generation sequencing were analyzed with BaseSpace (cloud‐based software, MSR: Metagenomics, version: 2.4.60.8). This metagenomics analysis classified organisms from V3 and V4 amplicon using a database of 16S rRNA data and performed a taxonomic classification using the Greengenes database showing species level classification in a graphical format (http://greengenes.lbl.gov/). The analysis output was a classification of reads at several taxonomic levels: kingdom, phylum, class, order, family, genus, and species. The analysis results included tables, cluster pie charts, phylogenetic trees and bar charts. The average and error bars of the relative abundance (%) of bacterial species from ewe’s milk and yogurt were calculated using Microsoft Excel 2010 software. Results & Discussion: A total of 40 bacteria as lactic acid bacteria were isolated from ewe’s drinking yogurt. Among isolated bacteria, two different genus of lactic acid bacteria were phenotypically characterized as 88% Lactobacillus, 3.5% Pediococcus and 8.5% Non-lactic acid bacteria. Isolates were identified by ribosomal DNA sequencing as Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus. The microbial community from ewe’s drinking yogurt were identified on the basis of Next-generation sequencing (NGS) at genus level as 94.08% Lactobacillus, 1.07% Pediococcus, 0.33% Streptococcus, 0.20% Enterococcus, 0.11% Candidatus Blochmannia, 0.11% Alkalibacillus, 0.06% Cohnella and 3.02% unclassified. At species level 24.82% Lactobacillus equicursoris, 51.81% Lactobacillus delbrueckii, 3.61% Lactobacillus apis, 2.79% Lactobacillus ultunensis, 0.86% Lactobacillus taiwanensis, 0.85% Lactobacillus gigeriorum, 0.42% Pediococcus argentinicus and 13.64% unclassified were identified. Findings of this study have provided fundamental knowledge on sanitary quality and microbial composition of drinking yogurt produced by Somar nomads. Both phenotypic and molecular identification methods showed Pediococcus and Lactobacillus genus as the dominant genera in these samples. Molecular identification results showed Lactobacillus delbrueckii as the dominant species. Four species, Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus were identified by both cultivation-dependent and cultivation-independent (NGS) methods. Rather, culture-dependent and culture-independent methods were found to be complementary in describing the microbial community of the ewe’s drinking yogurt produced by Somar nomads. The next-generation sequencing was found to be more accurate method in detecting the microbial diversity of drinking yogurt. The results showed poor hygienic quality of ewe’s drinking yogurt from Somar nomads, but there were no pathogenic bacteria in this product.

Abstract Gelatin is a protein hydrocolloid. Because of its unique characteristics such as gel forming, thickening, stabilizing, emulsifiing, foam and film forming, is widely used in food industries. In this research, in order to optimize the factors which affect enzymatic extraction method of gelatin ,the effects of three variables, enzyme concentrations(2-10 ppm), time(8-16 hours) and temperature(60-80 ˚C) on the yield of extraction, gel strength, viscosity and absorption in 420 nm were investigated. The rotatable central composite experimental design was used, and the data were analyzed by using of response surface regression(RSREG).Correlation coefficients of fitted regression models of yield, gel strength, viscosity and absorption for enzyme extraction method were determined as 0.953 , 0.998 , 0.995 and 0.935 , respectively.Analysis of variance for the overall effects of process variables in enzymatic extraction method on regression models showed that the enzyme concentration, the time of enzyme treatments and temperature had significant effects on gel strength and viscosity regression models, however the effect of temperature on both yield and absorption regression models was not significant(p > 0.05).The optimum conditions obtained from response surface regression models in enzymatic extraction method for yield, gel strength, viscosity and absorption which were verified experimentalls were (6.1 ppm, 15.6 hours, 70 ˚C), (9.1 ppm, 11.9 hours, 70.3 ˚C), (7.86 ppm, 14.9 hours, 77.5 ˚C) and (2.8 ppm, 10 hours, 60 ˚C), respectively. Key words: gelatin, enzymatic extraction, response surface optimization

Abstract Iced tea is a world popular beverage,for example about 80% of people in Italy and United States, consume iced tea as a thirsty-quenching beverage. However, it is also believed that iced tea contains health benefit components. Process of iced tea involved tea solid extraction and then mixing with edible acids, flavors, sugar or non-nutritional sweeteners. In this research, regarding to the demand market for new beverage, the possibility of production iced tea beverage using green tea leave was investigated and was extracted under predetermined conditions. The effects of extraction temperature and time on the extractability were examined. The results of extraction at various temperatures in sample demonstrated that the extracted solid yield increased steeply during the first 5-10 min of extraction, but gradually in next 10-30 min and after 30 min the extraction continued slowly. Tea cream and haze extract was also determined using gravimetry and spectrophotometric methods, respectively. The extraction components, which cause tea cream and haze formation in extract increased with increasing of temperature. A sharp increase was observed when extraction temperature increased from 50 to 60oC. There was no significant difference (p

Abstract Pistachio processing is one of the ways to increase the value added of pistachio. Production of pistachio butter is for this purpose. Pistachio butter is a paste form product that contain mainly milled, roasted pistachio kernel with sugar. The aim of this investigation is to produce pistachio butter using sunflower and sesame pastes. For this purpose, pistachio butter was formulated using sunflower and sesame pastes in two levels (10 and 20%). Rheological and organoleptic tests (from flavor, texture and color point of view) performed on the end products. The results were statistically analyzed by completely randomized Design and comparison between the means via Duncan's range test (5% level). The result of organoleptic test showed that the treatments 1, 2, 3 and 6 had higher scores. On the basis of organoleptic test, nutrition value as well as price product, suitable pistachio butter treatment was treatment 6. This formula contains 10% sunflower paste and 10% sesame paste.

Abstract Knowledge of desorption kinetics is essential to predict the behavior of the material during drying process and to design dryer equipment .The main objective of this study is to obtain the effective diffusivity coefficient and activation energy of shelled pistachio. Another goal is to find drying kinetics of shelled pistachio in fluidized bed dryer and so thin-layer characteristics of shelled pistachios were determined experimentally as a function of temperature and air velocity .Accordingly, 6 mathematical models (Two term model, Exponential model, Logarithmic model, Page model, Modified page model and Henderson & Pabis model) for describing the thin-layer drying behavior of shelled pistachios were investigated. Tests were conducted using four air temperature (25,30,45 and 60 C) ,and three air velocities (6, 8 & 10m/s).Out of the 6 models considered ,the two term model were considered to be the most suitable for describing the drying behavior of the shelled pistachios .Also, for high air temperature and velocity, Henderson-Pabis model proved to be suitable .Results showed that air velocity and operating temperature enhanced the kinetics of drying of shelled pistachio and the drying air temperature had a great effect on the drying kinetics. By using of Fick’s second Law the effective diffusivity coefficient and activation energy of pistachio was determined. Keywords : Effective Diffusivity Coefficient, Activation Energy, Drying Kinetics, Fluidized Bed Dryer, Pistachio Drying

Abstract In this study, a flexible package comprises of three layers, polyethylene (100μ), aluminium foil (9μ) and polyester (12μ) was used for packaging blackcherry preserves. All packed preserves were kept up to three months at 4 different storage temperatures (4, 23, 35 and 40°C). Physicochemical, microbial and organoleptical properties of all trials were determined monthly. As a result, the average pH, °Bx, acidity, Fe and Pb content were 3.99, 17.49, 0.25, 3.16ppm and 387.98ppb. All organoleptical properties of samples were acceptable. Temperature had statistically significant effect on the physicochemical and organoleptical properties of samples. The samples stored at 4 and 23°c were more acceptable due to their better quality. Flexible pouches have more advantages such as good colour and constant level of heavy metal as well as low cost and.. Keywords: blackcherry, laminated flexible pouch, packaging, preserve

Abstract In Iran, the majority of vegetable oil producers , use PET for packaging their products . Due to high solubility of PET oligomers in the oils , and shelf life of liquid oils , it is expected that some compounds migrate into the oil . This study was carried out to determine the amount of migration of terephtalates from PET bottles into sunflower oil and the effect of temperature and storage time on the degree of migration. 42 samples of liquid sunflower oil packed in one litre PET bottles, from single production bach of pars vegetable oil, were kept at 20˚C and 40˚C. Experiments were carried out on three bottles taken at different periods of time (10, 20, 30, 70, 145 & 202days). According to Castle method , alkaline hydrolysis of all PET oligomers to terephthalic acid followed by its methylation to dimethylterephthalate (DMT) for the measurement of DMT, derivative UV spectrophotometer was used according to Reeves.The results showed that the maximum level of migration of terephthalates at 20 ˚C was 29.43 + 0.93 and at 40˚C was 29.58 + 1.15. Therefore the amount of overall migration obtained in this research is lower than the international permitted level (lower than 60 ppm) and sunflower oil after the final migration can be safely consumed. Migration increased with the passage of time until it reached to its highest level and then stopped (P=0). Migration is faster when the temperature is increased (P=0.014). Therefore, migration is dependant on both temperature and contact time (P=0.001). In this research, linear dependence between migration and square root of time has also been demonstrated (r = 0.96 at 20 ˚C from time zero to 145 days and r = 0.95 at 40˚C from time zero to 70 days). Reproducibility of the method was evaluated by calculating the relative standard deviation which was equal to 3.21% and the detection limit of the method was 0.21 ppm. In conclusion migration of PET oligomers was dependant on time and temperature, until it reaches an equilibrium. Keywords: Plastic bottle, Migration, Sunflower oil, Polyethylene terephthalate (PET), Derivative UV Spectrophotometry , PET oligomers.

Abstract The effect of different solvent systems on the extraction of antioxidant and anti radical agents of grape seed was studied. For this purpose 6 different solvent systems with similar polarity and different selectivity were used to prepare grape seed extract. Extraction efficiency, reducing activity, radical scavenging property and the effect of each extract on the increase of thermal resistance (oxidative stability index) of antioxidant free soybean oil were analyzed in the form of factorial test in a totally randomized design with triplicate repetition. Reducing activity test proved that grape seed extracts (GSE) had a higher reducing strength compared with BHT and α-Tocopherol except for ethylacetat treatment which had no significant difference between the extracts. Results of radical scavenging activity were similar to reducing activity results. The evaluation of oxidative stability index showed that acetone treatment has had the maximum Carry-through properties Keywords: grape seed extract, antioxidant, antiradical, radical scavenging activity, solvent system, reducing power, oxidative stability index.

Abstract In this research, attention is focused on the resistantance of packages containing silver nanoparticles to gases such as oxygen as well as to the antimicrobial property of these packages. The effect of these packages on increasing quality and shelf time of the barberry was investigated in comparison with the current polyethylene packages. To do this, different microbial factors and the color of the barberry were investigated. The microbial experiments were done according to the national standards of Iran. The data obtained from microbial tests statistically considered by SPSS15 software. They showed decreasing microbial capacity, especially in the case of mold and counting total bacteria, packages containing silver nanoparticles had between 1% and 2% concentration of nanoparticles in comparison with the samples of polyethylene packages. Investigation of the apparent color of the samples was also done according to an average red color and brightness of the images taken from barberry seeds by Photoshop CS3 software, version10. The data obtained from these investigations statistically considered by SPSS15 software. The results showed that the apparent color is qualitatively better in the samples of packages containing 2% and 3% silver nanoparticles, compared with samples of polyethylene packages. However, a low concentration of nanoparticles, in the range of 200 part per million (ppm), did not produce a great effect on increasing either the quality or the shelf life in barberry, compared with ordinary polyethylene packages. Keywords: Barberry, Nanosilver package, Silver nanoparticles, Microorganism, Antimicrobial property, Polyethylene

Abstract In this study Lemon juice were packaged at three type of packaging ( PET , PE and Glass bottles ). The samples were stored ten weeks at 20 and 40 ◦C . Physicochemical (pH, acidity, brix, vitamin C , SO2 and formalin number ) and sensory properties of Lemon juice were evaluated on every two weeks. The results showed that the two storage temperatures(20 and 40 ◦C ) had not any significant effect on pH, acidity and brix of samples in different packaging (p≥0.05). The amount of vitamin C decreased on three type of packaging at the storage time that it was maximum in PE and minimum for glass bottles (p

Abstract On of the most important of sugar beets quality is amount of sodium and potassium, because this compounds are strongly molassogenic and reduction of yield. So , attention on reasons that change this compound in sugar beets and consequently in produced juice are very important. In this study, effect of size of sugar beet (obtained from different areas) on changes of sodium and potassium are investigated. Sugar beets that obtained from 3 areas , are sorted ( big size, medium size, small size and mixed size) and stored during 18 days industrial silo in Shirvan sugar factory. The results shown that amount of sodium and potassium related to cultivation areas and during storage amount of this compound change with size of sugar beets inversely. Namely , increasing of this compound in small size of sugar beets were more than others. Keywords : Size of sugar beets, Sodium, Potassium, Different cultivation areas, Storage in silo

Abstract In this study, ultrafiltrated Feta cheese was prepared from cow’s milk ultrafiltraton retentate and soymilk blend. Rennet and calcium chloride were used simultaneously as coagulant to coagulate cow’s milk proteins and soymilk proteins, respectively. Then, the effect of storage period on physical (Texture Profile Analysis test, Penetration test), chemical (total solids, protein, fat) and sensory (flavor, texture) properties of samples was investigated in 3, 20, 40 and 60 days after production. The results showed that during storage period physical properties decreased for both Texture Profile Analysis test and Penetration test. But, sensory and chemical characteristics of the product during storage did not significantly change, the way that the flavor and texture scores of the last day were still higher than the middle and the product after two months storage well was usable. Keywords: Soymilk, Retentate, CaCl2, Storage period, Cheese

Abstract In this research, production possibility and shelf life of frying margarine had analyzed. In order, the test was done in factorial form and totally random method. Tested factors were different kinds of margarine (counteractive effect between type of oil in oil phase (canola) and different moisture (16-8-4%) as the first factor and time of keeping margarine as the second factor. In this margarine formula, had not used milk because this product must be stable during heating. the results of analyses chemical properties(peroxide)and microbial properties(Mold and yeasts – Coliform – E.Coli and total count)shows: any margarines, after 14 weeks in room temperature (23°C) and refrigerator temperature (5°C) did not achieved to the unusable situation. Keywords: Liquid margarine, Canola Oil, Peroxide, Shelf life

Abstract Tomato seeds are the main component of tomato pulp and considered as an excellent source of edible oils, protein, and essential amino acids. Tomato seeds can be used as an important source of protein for human nutrition. The purpose of present study was to evaluate the effect of heat treatment on functional properties of tomato seed flour. The functional properties studied included water absorption capacity, oil absorption capacity, emulsification, foaming capacity and solubility. Isoelectric point of sample was around pH 4, while the highest solubility was observed around pH 12. The lowest value for all functional properties was observed at isoelectric point, which can be due decreased protein solubility at this point. Emulsion and foam properties of tomato seeds were desirable and therefore it can be used in some food formulation. Tomato seeds had some essential amino acid like phenylalanine, glutamic acid, aspartic acid, lysine and tryptophan. Keywords: Tomato seed, Chemical properties, Functional properties, Amino acids profile

Abstract In this study, total phenolics and flavonoids content, antiradical and antimicrobial activity of methanolic extract of two Iranian acorn varieties, namely Quercus.castaneifolia var castaneifolia and Quercus.branti var persica were evaluated. Total phenolic and flavonoid content and extraction yield of methanolic extract of castaneifolia variety (MC) were significantly higher than that of the extract of persica variety (MP). Extracts were also tested for their antioxidant activities using scavenging activity of 2, 2-diphenyl-1-picrylhydrazyl and compared with synthetic antioxidant namely BHA and BHT. EC50 values for MC, MP, BHA and BHT were 42.84, 70.40, 89.46 and 41.73 mg/ml, respectively. The extracts also showed good antimicrobial activity against all of tested microorganisms and the tested gram-negative bacteria was more resistant to the inhibitory effect of extracts. The ranges of minimum inhibitory concentration (MIC) of the extracts were 0.312-5 and 1.25-5 mg/ml for MC and MP, respectively. There was no difference between the MIC of MC and MB extract against Salmonella typhi and Shigella dysenteriae but MC extract showed the strongest activity on Escherichia coli and Yersinia entrocolitica at lower concentration. MP extract at concentration of 5mg/ml had bactericidal effect on all of gram negative bacteria (except Citrobacter). The most efficient bactericidal activity of MC extract was against Bacillus cereus, with MBC = 0.312 mg/ml while Shigella dysenteriae had the highest MBC (10mg/ml). A high-performance liquid chromatography was used for determination of phenolic acids of extracts. gallic, caffeic, p-coumaric and cholorogenic acid were found in MC and Gallic, caffeic, cholorogenic and sirinjic acid were detected in MP extract. Keywords: Acorn fruit, Antimicrobial activity, Gallic acid, Methanolic extract, Phenolic Compounds

Abstract Possibility of replacing whole soy flour for chocolate fat in chocolate production and its impact on textural, rheological and sensory properties of low fat chocolate was explored. For doing this, whole soy flour in 5 levels (0, 2,4,6,8 percent) and two refining times (105 and 135 minutes) was employed. Results indicated that longer refining time gave rise to reduction in particles size and increase in hardness of chocolate. With increasing refining time from 105 minutes to 135 minutes, hardness showed an upward trend which rose from 7100g to 8180g. Casson yield value and Casson viscosity ranged between 9.02 Pa to 35.09 Pa and 2.55 to 5.99 (Pa.s), respectively . Data revealed that whole soy flour up to 4% can be successfully substituted for chocolate fat, without causing significant difference in textural, rheological and sensory properties of chocolate samples (P

Abstract Green Tea is prepared from the leaves of Camellia sinensis. Catechins of Green tea are well known as natural antioxidants and have effective beneficial on the body. One of the most important processes in the extraction of catechins and producing green tea beverage is brewing process. The object of this study is to investigating the effect of brewing temperatures (60٫70 and 80˚c) and duration (5٫10 and 15 min) also the season effect of plucking on green tea that was produced in the Tea Research foundation of lahijan. results of total phenolic content on brewed green tea, is showed that plucking in summer and spring seasons samples have much total phenolic content are rather than plucking in autumn season samples also percent extraction of brewing green tea at 15 minuets has most highest total phenolic content than other seasons and brewing times .brewing temperature are not significant effected on the total phenolic content.

Abstract In this study, antimicrobial effects of Zataria Multiflora boiss added to sodium caseinate film on four bacterial species: Staphylococcus aurous, Escherichia coli, Bacillus subtilis and Salmonella intertidis was investigated. Disk diffusion method was used to study the antimicrobial activity of Zataria multiflora Boiss in sodium caseinate film. 9 mm disks were prepared from produced films with different concentrations of Zataria multiflora Boiss. with 1, 2, 3 and 4%. Surface culture was done under sterile condition using 0.1 ml of broth culture of each bacterial (106 -107 cfu/ml) on BHI agar. Then the disks were placed. Diameter of inhibition zone was considered as an index of antimicrobial activity of the film. Statistical analyses were done by means of SigmaSDAT software and mean comparison was carried out by LSD test. Results showed that disks containing essential oils of Zataria multiflora Boiss. in each concentration inhibited growth of E.coli, Sa.interitidis and B.cereus. Since there was no significant differences between 3% and 4% concentrations for these bacteria (p>0/05), concentration of 3% is the most appropriate and cost-effective concentration with the highest antimicrobial effect. Only the film containing 1% of essential oil of Zataria multiflora Boiss. Made no inhibition zone on S.aurous, in the other word had no inhibitory effect in this concentration. But inhibition zones created by 2, 3 and 4% for S.aurous were significantly different (p

Abstract Ozone is a strong oxidant and a potent disinfecting agent. There are numerous application areas of ozone in food industry. While there are many investigations on the application of ozone in food industry, relatively little information is available on the potential of ozone to reduce microbial populations in fresh-cut fruits and vegetables and the visual quality of lettuce. In this study, ozone water was applied at five concentrations (0.6, 0.8, 1.2, 1.6 and 2 ppm) for four exposure times (1, 3, 5 and 10 min) on natural microflora and E. coli O157:H7 and Salmonella inoculated of lettuce. The reduction in the total bacterial count, yeast and mold, total coliform, as well as lactic acid bacteria counts were examined. The promising results indicated the efficacy of ozone water to reduce the microbial populations on lettuce. In the best condition, the inoculated samples of E. coli O157:H7 (ATCC 35150, NCTC 12900), Salmonella typhi morium ( ATCC 14028, NCTC 12023) and Salmonella enterica subsp, enterica (PTCC 1709) on lettuce were decreased further than 2 log10 cfu/g. The results showed the population of aerobic mesophilic bacteria, yeast/ moulds, total coliforms and lactic acid bacteria were decreased to 1.54, 0.94, 1.94 and 1.35 log10 cfu/g respectively. The method of ozone generation, type of application, as well as the optimal exposure time and concentration of ozone as an antimicrobial agent on lettuce is mentioned in detail.

Abstract In recent years, water or sugar syrup, flavoring agents such as fruit juice or fruit juice concentrates and stabilizers have been added to the acidified dairy beverage composition. Nowadays, the popularity of low fat and defatted fruit yoghurt drinks are mainly growing. The purpose of this study was to diversify the acidified dairy products by determining the sensory, rheological and stability attributes of these kinds of dairy products with considering added elements and hydrocolloids as variables and then optimizing the formulation of fermented beverage, being directly flavored with the fruit concentrates. Moreover, mutual effects of total solid materials, concentrate, sweetener and stabilizer were inspected using Minitab software and response surface methodology. In this regard, consistency, viscosity, pH and acidity, sensory characteristics and yeast and mold counts were assessed. Surveys indicated that contrary to flow behavior index, the stability and straightness index increased with adding stabilizer and decreasing water content. According to sensory evaluation, white samples got lower score in comparison with black cherry ones. Furthermore, adding high amount of hydrocolloids negatively affected the total acceptance. Not only yeast but also mold was grown on the optimal sample after 28 day storage at refrigerator temperature. Generally speaking, it can be concluded that highly viscose and extremely sweet products as well as samples with high amount of stabilizer were rejected by panelists whereas the ones with high amount of concentrate were accepted. According to mentioned properties, the optimum amounts of ingredients are as follow: 13% total solid materials, 9.5% concentrate, 6.2% sweetener and 0.78% stabilizer. This sample with 2.3% of serum scored 7.93 in mouth feel, 8.25 in texture, 7.68 in acidic and 7.84 in fruit flavor, 7.89 in color, 7.78 in sweetness and 7.93 in total acceptance and also had 84.36% of total satisfaction.

Abstract Introduction: Flavor, taste, odor and color of fresh apple juice is unstable during concentration process and storage. Pectic substances and phenolic compounds are responsible for these physicochemical changes. So, decreasing of these compounds is necessary to improve the appearance and marketability of apple juice. In fruit juice industry, clarification is one of the most important steps which removes pectin, polyphenols and other unfavorable components and prevents haze formation during storage. Enzymatic clarification (depectinization) can be applied for removal of pectic substances by using pectinase. This enzyme can hydrolyze pectin and produce pectin-protein complexes which would be settled easily. Also in depectinization step, some enzymes such as amylase and amyloglucosidase can be used to degrade starch. Fining agents such as gelatin, bentonite, activated carbon, silicasol or a combination of these compounds can be used in conventional clarification. Sepiolite is a natural fibrous phyllasillicate clay mineral with a formula Mg8Si12O30(OH)4(OH2)4. nH2O(n=6-8) which has specific physicochemical properties such as high porosity, surface area and adsorption capacity. This clay clay has been used in several important applications such as decolorization of sugar juice, removal of phosphorus from vegetable oil and enhancing decoloration of crude palm oil. In this research, efficiency of Sepiolite for apple juice clarification was evaluated. First, the response surface methodology (RSM) was used to optimize apple juice clarification conditions. Then, a comparison among Sepiolite and other commercial fining agents in respect to clarification efficiency was accomplished. Finally, three types of zero-, first- and second-order kinetic models were used for explanation of changes in turbidity, color, viscosity and total phenolic content (TPC) during clarification process of apple juice. Materials and Methods: The pasteurized and unclarified apple juice, Bentonite, Gelatin (Bloom= 80-100), Amylase (Alphamyl MG) and Pectinase (Pectofruit XL) were gratefully obtained from Behnoosh Iran Co. (Shahrekord, Iran). Sepiolite (with specific surface area of 105 m2/g) was purchased from Farapooyan Isatis Yazd Co. (Yazd, Iran). The kieselgel and chemicals with analytical grade were purchased from Merck Co. (Germany). Sepiolite was activated with hydrochloric acid according to Balci’s method with slight modification. For evaluation of Sepiolite changes, some analysis like pH, acidity, density and the moisture content of Sepiolite clay were done before and after the activation by the method of Sabah and Çelik. Specific surface area was measured by using the BET method (Belsorp mini II, Japan). XRF method (PW148, Philips Co.) was used for determining of difference between Sepiolite elemental compositions before and after the activation. A pretreatment was conducted to improve the performance of fining agents according to Türkyilmaz et al.’s method with slight modification. The swelling capability of fining agents in water increases their clarification capacity. In the method of RSM, the independent factors at three levels were concentration of activated Sepiolite (0.05-0.1% w/v), temperature of clarification (50-60˚C) and process time (2-10 h). Juice turbidity was regarded as response. As the first step in clarification of apple juice, amylase and pectinase enzymes were applied (25 µl of each enzyme per 100 mL juice at 20˚C). The mixture was stirred and heated in an incubator at 55˚C for 1 h. Sepiolite was mixed with juice in certain concentrations, stirred and placed in definite temperature and time according to each run of RSM. Finally, the juice was centrifuged (12000 rpm for 5 min) to remove the clay from clarified juice. For kinetic studies, the above steps were done in the optimized conditions using 0.05% fining agents at 50˚C for 7 h. A portable turbidometer (MARTINI, Mi 415, Romania) and the capillary viscometer (Ubbelohde-Viscometer, Fisher, USA) were used for measuring the juice turbidity and viscosity at 20˚C and expressed as NTU (Nephelometeric Turbidity Unit) and centipoise (cp), respectively. Color was measured at 20˚C by using a color meter (ZE 6000, Nippon DENSHOKU). The parameters which used for color expression were L* and a* parameters based on CIE Lab system. The Folin-Ciocalteu reagent was used for measuring the total phenolic content of juice and expressed as mg gallic acid equivalent per 100 mL juice. To evaluate Sepiolite performance in juice clarification, following fining agents were applied at optimal conditions: sepiolite (S), commercial bentonite (B), and combination of these agents with gelatin (G) and kieselgel (K) (S+G, B+G, S+G+K, B+G+K). The used concentrations of bentonite, gelatin and kieselgel were 0.05%, 0.015% and 0.04% (w/v), respectively. Sampling was conducted at 1 h intervals to evaluate the changes in juice turbidity, viscosity, color and TPC during clarification process. The rates of changes were determined by three types of zero-, first- and second-order kinetic models. Results and Discussion: Results showed that the activated Sepiolite had less amounts of weight loss, density and pH than the native sample. On the other hand, moisture content and acidity increased. Also, acid activated Sepiolite had higher amounts of SiO2 groups. The second-order polynomial (quadratic) model was suggested as the best for describing the optimum conditions of clarification with insignificant lack of fit and high R2 (0.9845). Based on the results, process time had a significant (p