Iranian Food Science and Technology Research Journal

Abstract Lactobacillus spp are a group of gram-positive, non-spore forming, cocci or rod shaped, catalase negative organisms that benefit to the host. prebiotics are non-digestible food ingredients that stimulate the growth and /or activity of bacteria in the digestive system in ways claimed to be beneficial to health. this study was conducted in order to investigate the effects of selected probiotic microorganisms in combination with prebiotics, on a growth or activity of proteus mirabilis. in this study the antimicrobial activity of five probiotic lactobacillus spp. (Lactobacillus acidophilus(atcc 4356), Lactobacillus Plantarum (ATCC 8014), Lactobacillus Fermentum (PTCC 1638), Lactobacillus Casei (PTCC 1608) And Lactobacillus Rhamnosus (PTCC 1637)) And Combination of probiotic and prebiotics (synbiotic) (Lactobacillus Spp. + five prebiotics : inulin, , trehalose , raffinose, lactulose and riboflavin) tested for their antimicrobial activity against proteus mirabilis (atcc 7002 and ptcc 1076) growth with agar well diffusion (awd) method. results showed that Lactobacillus Spp. had more antimicrobial activity against proteus spp., followed by inulin, , trehalose , raffinose , lactulose in comparison to basic mrs media (p

Abstract Introduction: Plant extracts have antimicrobial properties and can be substituted as chemical flavorings in food. Preservatives are compounds that are used to inhibit the growth or to eliminate harmful microorganisms to increase the shelf life of foods. Nowadays, the use of natural preservatives derived from medicinal plants is increasing due to their greater compatibility and the presence of volatile compounds (Celiktas et al., 2007). The antimicrobial properties, antioxidant and anticancer effects of these natural additives have been proven (Tajkarimi et al., 2010). In this study, the antimicrobial activity enhancement effect of the combination of hydroalcoholic extracts of basil, cinnamon and salvia on Escherichia coli, Staphylococcus aureus and Saccharomyces cerevisiae yeast in Iranian yoghurt drink (doogh) was investigated for 4 weeks at ambient temperature.
 
Materials and Methods: The milk was boiled in hygienic conditions at 95 ° C for 5 min. After cooling to 45 ° C, they were inoculated. The aerial parts of the studied plants were milled and powdered. Cinnamon, basil and salvia extracts were then soaked. The food strains of Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 700728 and Saccharomyces cerevisiae PTCC 5193 were prepared as lyophilized ampoules. The microdilution broth method was used to determine the minimum inhibitory concentration. The minimum bactericidal concentration (MBC) was determined in accordance with the minimum inhibitory concentration (MIC) results. To determine the antimicrobial effect of the extracts on the yoghurt drink, 9 ml of the prepared yoghurt drink was poured into each test tube. Then 1 cc of each extract and 1 cc of microbial suspension (1.5 × 108 CFU / ml) were added. One tube was considered as positive control (bacteria + yoghurt drink), one negative control tube (extract + yoghurt drink) and one control tube (yoghurt drink only) and the tubes were placed at ambient temperature. Then, on day 7, 14, 21 and 30 during storage, 20 µl of each tube, were cultured on Muller Hinton agar medium and the same amount of yeast was cultured on blood agar medium. After incubation for 24 h at 37 ° C, the colonies were counted. The interaction of antimicrobial activity of the combination of basil, cinnamon and sage extracts was evaluated on the basis of differential inhibitory concentration index (FIC).
 
Results and discussion: The results showed that the minimum inhibitory concentration of the combined basil, cinnamon and sage extracts against Staphylococcus aureus and Saccharomyces cerevisiae and Escherichia coli were 0.4, 0.4 and 3.12 mg / ml, respectively. Also, Staphylococcus aureus was more susceptible to the extracts, which were used alone, and was inhibited by a lower concentration of used extract (Ahmadi et al., 2018). However, due to the maximum minimum inhibitory concentration (MIC), Escherichia coli was less sensitive to the extracts which was used alone. The combined usage of all three extracts significantly reduced the maximum minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC), indicating that their antimicrobial activity was more effective against the studied microorganisms than each of the extracts which was used alone. The results of this study showed that synergistic effect against Staphylococcus aureus and Saccharomyces cerevisiae was more effective with the combination of the aforementioned extracts (p <0.05). The results of the Escherichia coli population counting during storage indicated that most of the extracts had a good effect on preventing the growth of Escherichia coli in the doogh environment compared to the control sample (p <0.05). Addition of the extract significantly prevented pH reduction over time (p <0.05), so that the control sample had the highest and the sample containing all three extracts showed the lowest pH changes over time (p <0.05). Therefore, it can be concluded that acid production by Lactobacillus bacteria in samples containing extract during storage period was higher than control. The results of this study were in agreement with the results of Mortazavian et al., (2007) and Voosogh et al., (2009). The acidity of the doogh samples increased significantly over time (P<0.05), while the addition of the extract significantly prevented the acidity increase over time (P<0.05). Sensory properties are the main factors of acceptance and satisfaction of many products. In this study, the mean viewpoint of doogh samples containing the combination of the three above mentioned extracts in terms of taste, odor, color and general acceptance are acceptable. Additionally, it was found that about 90% of participants were willing to use it. Although studies of the overlapping or synergistic effects of medicinal plant extracts in real food environments are not extensive, their results have shown that, the addition of different medicinal plants compounds can increase antibacterial effects. Therefore, the simultaneous use of these extracts can be used in effective control of food pathogens as a complementary method. The results of this study were in agreement with the results of Karimi (2007).

Abstract Introduction: Fish is the most extremely perishable food products (Roiha et al, 2018) and its quality may be affected by many elements (García et al, 2015). The techniques used for freezing and thawing processes play an essential function in maintaining the quality of the frozen foods. If freezing and thawing processes are carried out accurately, the quality of frozen fish will be near to fresh quality after thawing (Duygu and Ümit, 2015). There are various methods for thawing of frozen food products like still air thawing, air blast, refrigerator thawing, cold and warm water thawing, warm salt-water thawing, static water thawing and a number of innovative approaches such as high voltage electrostatic field (HVEF) thawing, ohmic, microwave, pressure-assisted, acoustic, radio frequency, infra-red and high hydrostatic pressure thawing (Mousakhani-Ganjeh et al, 2015; Mousakhani-Ganjeh et al, 2016). During Ohmic heating (OH), electrical energy is altered to thermal energy within a conductor by applying an alternative current across the food product (Darvishi et al, 2013). The energy is approximately completely dispersed within the heated food product (Shim et al, 2010). A large number of applications exists for ohmic treatments including heating, cooking, thawing, blanching, evaporation, dehydration, pasteurization, fermentation and extraction (Athmaselvi et al, 2017; Boldaji and Borghei, 2015).
 
Materials and methods: Tuna fish (Thunnus albacares) obtained from Esfahan Pegah Co., Isfahan, Iran and transferred to the laboratory. The white fresh fish muscles were divided into cubes (3 × 3 × 3 cm3) and instantly frozen at -30°C after vacuum packaging in polyethylene bags. The frozen samples kept at -18°C until the day of experiments. The experimental apparatus of ohmic heating comprised of a power supply, an isolating variable transformer, power analyzer and a microprocessor board. The ohmic cell was made of PTFE cylinder with two displacement stainless steel electrodes. Temperature was measured with a K-type thermocouple. The electrical conductivity (σ, mS/cm) of the brine solutions was determined before thawing at 25°C. The electrical conductivity of fish minced paste was also measured at 4°C. In the present study, the tuna cubes (27 cm3) were thawed under constant ohmic power intensity (50 V) at three different brine concentrations (0.3, 0.4 and 0.5 NaCl, %w/v) during three time intervals (0, 24 and 48 hours). The parameters associated with the quality of tuna such as thawing time, thawing rate, thawing, cooking and total losses, centrifugal loss, lipid oxidation, texture and color were investigated during OH thawing. Changes in the thawing, cooking and total losses, WHC, texture, L*, a*, b* and color changes were studied as kinetic models.
 
Results and Discussion: Results showed that, thawing under immersion ohmic thawing significantly decreased the thawing time of frozen tuna fish cubes. Suitable kinetic models with the highest regression coefficient described dependent parameters. In addition, kinetic models were validated by R2 and RMSE. Statistical analysis showed that the interaction effects of two parameters (concentration * time) on thawing loss were significant (p0.05). The lowest thawing loss was observed at 0.3 and 0.5 %w/v NaCl immediately after thawing. The lowest cooking loss was seen at highest brine concentration and the lowest total loss was observed at time zero after thawing (p0.01). The WHC of meat product is one of the most important factors affecting economical value and meat quality due to the weight change during thawing. In this study, WHC increased by increasing the brine concentration. In addition, oxidation of lipids did not occur, and TBA index did not differ significantly. This was probably due to the high speed of immersion ohmic thawing. The highest shear force was related to the treated sample with the lowest brine concentration. The highest a* was indicated immediately after thawing. Immersion ohmic thawing saved time and led to reducing the losses parameters. In addition, WHC was maintained at the highest possible level. Fish and fishery products are very perishable materials and no oxidation was observed during immersion ohmic thawing regarding the presence of NaCl,.

Abstract Introduction
Efforts have always been made to protect valuable compounds of medicine, food and aromatics materials that are highly sensitive to environmental conditions by the encapsulation method. encapsulation of flavors, in addition to its protection, allows the aromatic substance to be released in a long time, and the time and place of its release can be controlled. To design these protection systems requires detailed information on encapsulation and release methods, the nature of walls and aromatic materials (Gunning et al.,1999). For encapsulation of sensitive compounds such as lipophilic materials, it is necessary to produce an emulsion of the desired substance in wall materials such as proteins, polysaccharides or a mixture of them. The important factors in encapsulation are the molecular weight, chemical properties and polarity of the core materials, the properties of the materials of the walls, and finally, the methods used to produce microcapsules. (Jafari et al., 2008).
The aim of this study was to produce and evaluate the properties of two and six layer multilayer microcapsules containing limonene using soy protein isolate and starch modified by spray drying. The release of encapsulated limonene was investigated under artificial oral conditions under different stress conditions. The results of this study can be used to predict the release rate of the encapsulated flavors and their release conditions.
Materials and Methods
Solution preparation: The solution of SPI (0-3%) was prepared by methods of Huang et al. (2012). The OSA starch stock solution (0-2%) was prepared by methods of Nilsson and Bergens (2007).
Emulsion’s preparation: the primary emulsion of the optimum SPI and secondary emulsion of optimum OSA starch concentration prepared by the method of Noshad et al (2015).
Microcapsule production: To prepare the Microcapsules, a laboratory spray dryer was used. 180±5 ᵒC, inlet air temperature, 25 (ml/min) feed rate, and 90±10 ᵒC outlet air temperature were used. Six layer microcapsules was also prepared in the same conditions (Ansarifar et al., 2017)
The micro structure, morphology and release of limonene were evaluated and finally by Zero order, First order, Higuchi, and Korsemeyer- peppas models were used to the fitting of experimental data.
Limonene release: To investigate the release of the encapsulated limonene, the release of these microcapsules (two and six layer) at 37 ° C and pH = 6.8, as well as frequent chewing (0, 50 and 100 rpm) were examined. For the apply of shear stress, an oral simulator was designed and developed by the Department of Food Science and Technology of Ferdowsi University of Mashhad was used.
 
Results and Discusion
The results of particle size changes of the initial emulsion formed with different levels of soy protein isolate showed that the particle size decreased with increasing the concentration of this protein to 1.5% and then it was increased. The results of zeta potential showed that with increasing the concentration of soy protein isolate to 1.5%, the zeta potential of the samples increased and with more than 1.5%, it did not have much effect on the zeta potential of the samples, which indicates that concentrate of 1.5% soy protein isolate has a good ability to cover surface of limonene particles. Similarly, 1.2% of OSA starch was determined for the secondary layer.
SEM images of the microcapsules showed that in the two-layer wall microcapsules have cavities, cracks and shrinkage. In the starting of drying, the rate of moisture lost is high and on the other hand, the wall is not strong enough to withstand the stresses caused by the exit of moisture from the walls, so the microcapsule has cavities. In six-layer microcapsules, a smooth, non-cracked surface was observed, which can be attributed to the wall strength due to the increase in the number of layers. Fourier transform infrared spectroscopic (FTIR) test showed that the outer surface of the microcapsules was covered by OSA starch in two and six layer microcapsules.
The release profile of encapsulated limonene showed that the release rate in two layer samples was faster than six layer samples. Also, with increasing shear rate, the amount of release increased. The results of experimental models fitting showed that the first-order model had the best description for releasing limonene from two- and six-layer samples in different conditions. Calculation of diffusion coefficient showed that six-layer microcapsules have a lower diffusion coefficient than two-layer microcapsules, which leads to a decrease in the release rate of limonene.
Conclusion
 The results of this study showed that the layer-by-layer method could be used to produce limonene microcapsules. Soy protein isolate and modified starch can cover limonene droplets well. SEM images showed that the structure of six-layer microcapsules is free of cracks and cavities and has a more uniform surface than two-layer microcapsules. To investigate the mechanism of limonene release from two- and six-layer microcapsules, different kinetic models were used to fit the experimental release data. The results showed that the release of these microcapsules occurred based on the diffusion mechanism and Fick's law, which is the main mechanism of mass transfer in the release process. Also, the results showed that the six-layer microcapsules had a lower diffusion coefficient than the two-layer microcapsules and the release rate was lower in the two-layer microcapsule; This is due to the repetitive coating of soy protein isolate and modified starch around the microcapsules and the increase in wall thickness.

Abstract Introduction
Celiac disease is one of the most common digestive disorder. Chicken nugget is one of the most popular instant and ready-to-eat foods, and wheat flour is one of its main coating ingredients, which contains approximately 60% gluten. Quinoa is a gluten-free grain, as a good source of dietary fiber, has various applications in the meat products processing system as a stabilizer, fat substitute, structural components, etc. The addition of hydrocolloids also helps to improve the rheological properties of gluten-free products. The purpose of this research was to evaluate the effect of quinoa-corn mixed flour in the preparation of nugget batter as a gluten-free combination as an alternative to wheat flour, and also to investigate the effect of adding HPMC hydrocolloid on the final product characteristics. In this research, a rotatable central composite design was used to investigate the effect of two independent variables including different proportions of quinoa-corn flour (0-100, 50-50, 100-0%) and different levels of hydrocolloid (0.5-1-1.5%) on the quality characteristics of nugget. With the increase of quinoa replacement level, moisture content (0.60), batter pick up (138) and redness level 5.5 (a*) increased, and oil content (11), hardness (7.5), brightness level 41(L*), yellowness level 20(b*) decreased. The increase of HPMC also caused an increase in moisture content (0.59), brightness level (L*) of 0.39, batter pick up (137) and decrease in oil content (10) and hardness (7). Optimum conditions for the production of gluten-free nugget were determined by considering the optimal amounts for the production of high quality and healthy products, contained 90% quinoa and HPMC at a level of about 1%.
 
Materials and Methods
 Corn flour was purchased from the pilot of Ferdowsi University of Mashhad. The de-saponified quinoa was prepared from Kashmir and then ground. In order to make the grains more uniform, both flours were sieved using a 30 mesh. Hydrocolloid hydroxypropyl methylcellulose was also prepared from Kian Shimi Mashhad. Oyla frying oil was used for frying the samples.
The chicken nugget formulation was a mixture of 86% minced chicken, 10% onion, 1.5% garlic powder, 1% salt and 1.5% pepper. After complete mixing, these materials were poured into a freezer bag until a homogeneous and uniform mixture was obtained, and they were flatted until they reached the desired thickness (1 cm). Plastics containing chicken paste were stored in the freezer for 2 hours to facilitate cutting. Then molding was done with a circular mold with a diameter of 4 cm (Dehghan Nasiri et al., 2012).The batter formulation consisted of flour, water, baking powder, salt and hydrocolloids. In order to investigate the effect of quinoa and corn flours, and hydrocolloids, these substances were added to nugget water paste in different percentages (quinoa-corn ratio: 0-100, 50-50, 0-100 and hydrocolloids at the level of 1-1 / 5 -0.5%) and then mixed with water by mixer for 1 minute. The molded samples were first coated with flour and then immersed in the batter for 60 seconds and dripped for 30 seconds. Finally, deep frying was performed in the fryer at 170 ° C for 3.5 minutes. The fried samples were taken out of the fryer basket and the excess oil on the surface of the nuggets was removed with absorbent paper. The oil was changed after twice frying. After cooling the samples at room temperature, the tests such as moisture content, oil content, texture (hardness), color, batter pick up, peroxide and overall acceptance were performed.
In this study, Design Expert 10.0.7 software and a rotatable central composite design to investigate the effect of two independent variables including different ratios of quinoa-corn flour (0-100, 50-50, 0-100%) and hydrocolloid (0.5-1-1.5%), Was used on the quality characteristics of the nugget. Finally, different models were fitted to the data obtained from the experiments and the best model was selected according to the results of analysis of variance.
 
Results and Discussion
With increasing quinoa replacement level, moisture content, redness (a*) and pH increased and oil content, batter pick up, texture (hardness), brightness (L*), yellowness (b*) and cooking loss decreased. Increasing the HPMC also increased the moisture content, brightness (L*), cooking loss, batter pick up, and decreased oil content and hardness. Optimum condition for production of gluten-free chicken nuggets, considering the appropriate properties was found to be 90% quinoa flour and 1% HPMC.
 
Conclusion
 In general, it can be concluded that the addition of quinoa and HPMC leads to the production of high quality products with high moisture and low oil content and high nutritional value.

Abstract In this research the effect of oil type, process time ,temperature and pre-treating methods on moisture content, oil uptake, acidity and peroxide values of Zucchini slices (Cucurbita pepo. L) during deep fat frying process were investigated. The samples were pretreated by blanching (97 ºC for 5 min) and microwave (900 W for 2min) methods before frying process. Frying experiments were carried out at two temperatures of 130 and 170 ºC for 7 and 4 minutes respectively by using two types of oil i.e. sunflower and special frying oils. The results showed that moisture content, oil uptake, acidity and peroxide values were significantly affected by temperatures, pretreatments and oil type (p

Abstract Introduction: Tomato is one of the most important vegetable crops in Iran and is grown commercially in every state in the country. Tomatoes are climacteric in nature and climacteric fruits submitted to gamma irradiation exhibit a delay of ripening. In the specific case of tomatoes, irradiation generally delays ripening when the treatment is applied at the pre-climacteric stage. Mechanical properties are very important quality property in tomato. Determination of the storage time effect on the evolution of this quality is a desirable objective for producers, distributors and marketing agencies, who need reliable firmness measuring instruments for commercial purpose. Previous studies carried out by different researchers show that impact techniques can be used to evaluate firmness of fruits successfully. Quick and nondestructive methods for measuring texture are critical for controlling postharvest quality of crops and fruits. Polymer films are ubiquitous in the food industry, fulfilling a range of functions including a significant role in reducing food waste. Also, it can be possible to extend shelf-life with some coatings, including polymer films. Materials and Methods: In this study, tomatoes were irradiated in Atomic Energy Organization of Iran. For irradiation of samples, cobalt 60 (Gamma Cell 220) was used. The samples were irradiated with doses of 0 (control), 0.25, 0.5 and 1 kG, then transferred to the laboratory and kept in a refrigerator at 6 ± 1 ° C and 65 ± 4% relative humidity for 21 days. In order to pack, polyethylene film with medium density (thickness of 0.3 mm and depth and width, respectively, 6.5 and 19 cm) were obtained from the Iranian Polymer Research Institute. Experiments were performed on samples coated with polyethylene film in 7 days intervals. Acoustic tests were performed using Impact Test System. The system was covered with aluminum chamber and inside with wood and clouds. The system was internally equipped with the sample location on the floor, the impact mechanism and the receiver of the signal. In this audio excitation system, samples were taken with the help of a blow. By applying a blow to the sample surface, the audio signal was sent to the sample and then measured by a receiver placed at a distance of 7 mm from the sample. The experiments were performed every 7 days. During the experiment period, the physical and mechanical properties of the samples were measured. Data were analyzed using SPSS.20 software. Correlation between hit parameters and firmness of penetration test were checked out using regression in Excell .2013 software, and predicted a suitable model for determining the firmness of tomato. Results and Discussion: The results showed that after 21 days of storage time, the amount of mass and density for irradiated sample with a 0.5 kGy dose in polyethylene film compared to control sample (uncoated) decreased to 22.53 and 12.34 %, respectively, and had more resonant frequency to 26.58%. Also, irradiated sample with a 0.5 kGy dose in polyethylene film compared to samples irradiated with doses of 1 kg and non-irradiated samples in polyethylene film had higher modulus of elasticity and firmness to 37.74, 26.48 % and 25% and 18.12%, respectively. The maximum penetration force in destructive testing had strong relationship with the parameters obtained from Acoustic test such as resonant frequency, Strength index and Modulus of elasticity with a correlation coefficient to 0.893, 0.913 and 0.886, respectively. Combination of polyethylene film with 0.5 kG irradiation on the changes in mass and volume, strength coefficient, resonance frequency, elasticity modulus and rigidity obtained from the impact test have the best results. Also, combination of polyethylene coating and 21-day storage time on mass and volume changes, strength coefficient, resonant frequency, elasticity modulus and stiffness from the impact test reduced the storage performance. According to the results of this study, by irradiation of a sample of tomatoes with a 0.5 kG and using a polyethylene film, it can be stored with a slight change in stiffness and texture for a period of 21 days, and possibly more, which causes increase the shelf-life in the warehouse, reduce storage costs in the warehouse by conventional methods and increase the possibility to export. As a summing up, irradiation in combination with Polyethylene films is a good way to preserve tomatoes tissue and Acoustic textures is a useful way to be replaced with Penetration test

Abstract Introduction: Grape is a non-climacteric fruit with a low rate of physiological activity but is subject to serious physiological and parasitic disorders after harvest and during long term storage (Ciccarese et al., 2013). Currently, Edible coatings have been studied as potential substitutes for conventional plastics in food packaging. Edible coating is a thin layer of edible material formed as a coating on a food product. Edible coating can offer several advantages to the fresh fruit and vegetable industry such as improvement in the retention of color, acids, sugar and flavor components, the maintenance of quality during shipping and storage, the reduction of storage disorders and improved consumer appeal (Antoniou et al., 2015; Cazon et al., 2017; Fakhouri et al., 2015; Galus & Kadzińska, 2015). Farsi gum as a novel source of polysaccharides has drawn much attention in a wide range of various fields such as pharmaceutics, food and cosmetics industries. Functional properties of Farsi gum are influenced by its structure and molecular weight (Hadian et al., 2016; Joukar et al., 2017). By inclusion of bioactive compounds in the Farsi gum network the aforementioned impairments could be overcome and moreover, new protective and functional valences could be added. The inclusion of lipid-based component in Farsi gum gives it excellent light and moisture barrier properties. The benefic impact on human health of hemp seed oil is worldwide recognized. A recent study demonstrated the antimicrobial properties of hemp seed oil. Due to their abundance in biologically active compounds, hemp seed oil is promising natural alternatives that may extend the shelf-life, microbiological safety and nutritional values of food (Cozmuta et al., 2015; Leizer et al., 2000; Salarnia et al., 2018). Growing awareness of the quality of fruit has necessitated increasing effort to develop rapid and non-destructive methods for evaluating fruit quality (Bhargava & Bansal, 2020; Rachmawati et al., 2017; Tao & Zhou, 2017; Wu & Sun, 2013). The aim of this study was the consideration of image processing application for grape sorting based on visual surface characterize.
 
Materials and Methods: Coating emulsion was prepared using (Farsi gum (0%, 1.5% and 3%), hemp seed oil (0%, 0.075% and 0.15%) and glyceride (0.3%)). grape fruit were coated by immersion in coating dispersion for 5 min. Samples were then allowed to loss the excess coating dispersion. Coatings were developed at room temperature during an hour. Samples were refrigerated at 4± 1°C for 28 days and analyses were performed at days 0 and 28. Defect identification and maturity detection of grape fruits are challenging task for the computer vision to achieve near human levels of recognition. The image acquisition was performed in a homogenously controlled lighting condition. Considering the camera lens’s focal length, the samples were placed 25 cm under the camera’s lens to be under camera’s field of view. The images of grape were segmented from the background using thresholding of the high contrast images via MATLAB software (R2019a, image processing toolbox). The optimum threshold value was obtained to be 0.35, 0.45 and 0.30 for R, G and B channel, respectively.
 
Results and Discussion: The proposed techniques can separate between the defected and the healthy grape fruits, and then detect and classify the actual defected area. Classification is performed in two manners which in the first one, an input grape is classified with two different algorithms (RGB and binary). The Result showed that the accuracies for detecting the surface defects on grape were 97.73% and 96.30% using RGB and binary algorithms, respectively. Proposed method can be used to detect the visible defects of coated grape, and to grade the grape in high speed and precision.
 
Conclusions: The results of this research and similar ones can provide helpful recommendations in grading fruits for fresh consumption. The simplicity and the efficiency of the proposed techniques make them appropriate for designing a low-cost hardware kit that can be used for real applications.

Abstract Introduction: It has been well demonstrated that vegetables provide, in addition to other basic nutrients, bioactive substances with beneficial effects on human health. In fact, the consumption of vegetables has been associated with lower incidence and lower mortality rates of cancer and cardiovascular diseases in humans. Increasing demand for natural additives has shifted the attention from synthetic to natural antimicrobial agents. Leafy vegetables are found to be good source of antimicrobial agents. This study was aimed to examine the antimicrobial activity of leaf extracts of pimpinella affinis. Pimpinella affinis is a member of the family Apiaceae. This biennial herb grows up to 110 cm tall and is native in central and northern parts of Iran. In traditional medicine this herb is being used as carminative agent, appetizer, diuretic, antispasmodic drug, antimicrobial, sedative and lactation medication. It has also been distinguished as an antioxidant and antibacterial agent. There are several methods of obtaining extract from plants including maceration, super critical fluid extraction, subcritical water extraction, microwave and ultrasonic assisted method. Materials and Methods: After collection from natural habitats of Pimpinella affinis in Mazandaran Province, it was then approved by the Department of Botany of Faculty of Agriculture of University of Sari. The plant was dried in a dry and dark place away from the sun and then was pulverized in the mill and sieved by a mesh of 80 (800 microns). Pimpinella affinis extract obtained by using maceration extraction (ME), ultrasonic assisted method (UAE) and supercritical fluid extraction (SFE). Ethanol: water in 50:50 ratio used as solvent for extraction. Total phenolic content of different extracts was measured by Folin-ciocalteu method. The phenolic compounds fractions were determined using Liquid chromatography–mass spectrometry system. After preparing the mother culture medium, the bacteria were cultured in MHB medium (37 ° C) for 24-18 hours. Stock solutions were prepared from each of the extracts. Serial dilutions of the extracts at concentrations of 0.01 to 10 mg / ml in 2.5% dimethyl sulfoxide were prepared and then sterilized with 0.22 μm pore size syringe filter. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration assay (MBC) were determined by micro dilution method for listeria monocytogenes (ATCC19112), staphylococcus aureus (ATCC25923), pseudomonas aeruginosa (ATCC9027) and Escherichia coli (ATCC25922). Antimicrobial growth was inhibited by measuring the absorbance and ELISA Reader was used to determine the growth rate of microorganisms, and the first house with the lowest absorption read as MIC (mg /ml) was determined. Statistical analysis of MIC, MBC and phenolic compounds of extracts results was done in a completely randomized design and using SPSS software version 20. The comparison of the means was done using Duncan’s test and one-way ANOVA method. In order to reduce the error, all experiments were performed in triplicate. Results and Discussion: Total phenolic content of extracts ranged between 1502.25 to 1836.69 mg GA/100g E. The results showed that the ultrasonic assisted method have highest total phenolic content and the least phenolic content was observed in extract which obtained by supercritical fluid extraction. Chlorogenic Acid, Cafeic acid and Apigenin-6-C-glucoside were the predominant fractions in Pimpinella affinis which detected by Liquid chromatography–mass spectrometry system. The least and highest amount of MIC and MBC were belonged to ultrasonic assisted and supercritical fluid extracts, respectively. Staphylococcus aureus was most sensitive and Escherichia coli and Pseudomonas aeruginosa were most resistance bacteria. Pimpinella extract due to having phenolic compounds such as Gallic acid, Cafeic acid, Chlorogenic Acid, Kaempferol and Apigenin showed antimicrobial activity and can be used as natural antimicrobial agent.

Abstract Spirulina platensis is a blue-green microalga with unique nutrient content and several therapeutic aspects which has been used for fortification of different foods. In this study, the effect of Spirulina platensis powder in different levels (0, 0.5, 1 and 2 percent), added in two stages (before pasteurization and at same time with starter culture) was studied on the microstructure and acidification characteristics of yogurt during fermentation time. The results showed that different levels of Spirulina biomass had significant effect on acidification kinetics parameters of yogurt samples (p

Abstract Introduction
Whey proteins are among the most valuable functional ingredients derived from dairy industry. Whey proteins possess high nutritional quality, rapid digestibility, and multifunctional techno-functional properties such as solubility, emulsifying capacity, foaming ability, and fat-binding potential. The major whey protein fractions, including β-lactoglobulin, α-lactalbumin, immunoglobulins, lactoferrin, and bovine serum albumin, play a crucial role in improving texture, stability, and sensory quality of food formulations. Consequently, whey protein powders are extensively utilized in dairy products, functional foods, beverages, sports nutrition, and pharmaceutical formulations. Drying is a critical step in whey protein powder production, directly influencing product quality and functionality. Spray drying is the most widely used industrial method due to its cost-effectiveness and scalability; however, thermal stress during the process may induce protein denaturation, aggregation, reduced solubility, and wall deposition, ultimately decreasing powder yield and functional performance. Freeze drying, although effective in preserving protein structure, is limited by high energy consumption, long processing time, and low economic feasibility. Therefore, improving spray drying efficiency while maintaining or enhancing whey protein functionality remains a major industrial challenge. In recent years, ultrasound has gained attention as a non-thermal and environmentally friendly processing technology capable of modifying protein structures through cavitation-induced mechanical effects. High-intensity ultrasound can disrupt protein aggregates, alter secondary and tertiary structures, reduce particle size, and improve dispersion stability. Despite numerous studies reporting the positive effects of ultrasound on dairy proteins, comprehensive investigations on the combined effects of ultrasound pretreatment and drying methods on whey protein powder characteristics are still limited. Accordingly, the present study aimed to evaluate the influence of ultrasound pretreatment and to compare its effects with conventional spray drying and freeze drying on the physicochemical, structural, and functional properties of whey protein powder.
Materials and Methods
Pasteurized low-fat milk (1.5% fat) was used for whey protein extraction using an acid precipitation method. The obtained whey was subjected to ultrasound pretreatment using an ultrasonic bath operating at 20 kHz. Treatments were applied at power levels of 100, 200, and 300 W for durations of 5, 15, and 25 min. The treatment temperature was maintained below 30 °C using an ice-water bath to prevent thermal denaturation. Ultrasound-treated samples were dried using a spray dryer under controlled conditions (inlet temperature 170 °C, outlet temperature 70 °C, feed solids 20%). Control samples were produced without ultrasound pretreatment and dried either by spray drying or freeze drying. Freeze drying was performed at −80 °C followed by sublimation under vacuum (0.01 mbar). Powder yield, protein solubility, fat absorption capacity, emulsifying activity index, and foaming capacity were determined using standard methods. Structural and physicochemical properties were analyzed using Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD), scanning electron microscopy (SEM), particle size analysis, and zeta potential measurements. All experiments were conducted in triplicate. Statistical analysis was performed using ANOVA, and optimization of ultrasound conditions was carried out using response surface methodology.
Results and Discussion
Ultrasound pretreatment significantly improved spray drying performance and functional properties of whey protein powder (p < 0.05). Powder yield increased from 46.29% in the control spray-dried sample to a maximum of 72.27% in ultrasound-treated samples, primarily due to improved atomization, reduced feed viscosity, and decreased wall deposition. Protein solubility showed a substantial increase, reaching up to 98.11% after ultrasound pretreatment, which was attributed to protein unfolding, exposure of hydrophilic groups, and reduced aggregation. Although fat absorption capacity decreased in ultrasound-treated samples compared to freeze-dried controls, extended ultrasound treatment partially restored this property, indicating a balance between structural unfolding and reorganization. Emulsifying activity and foaming capacity were markedly enhanced in the optimized ultrasound-assisted spray-dried sample, correlating with reduced particle size, higher surface charge, and improved colloidal stability. FTIR analysis revealed changes in amide I and II bands, suggesting alterations in secondary protein structure without affecting the primary structure. XRD patterns indicated an amorphous structure for all samples, with ultrasound-treated powders exhibiting a more compact amorphous arrangement. SEM images confirmed that ultrasound-assisted spray drying produced smoother, more uniform particles with fewer surface irregularities. Optimization results identified ultrasound treatment at approximately 273.5 W for 25 min as the optimal condition for maximizing yield and functional performance.
Conclusion
This study demonstrates that ultrasound pretreatment prior to spray drying is an effective and practical strategy for enhancing the quality and functionality of whey protein powder. The synergistic combination of ultrasound and spray drying significantly improved powder yield, solubility, emulsifying activity, and foaming capacity while promoting favorable structural modifications such as reduced particle size, improved surface uniformity, and increased colloidal stability. Compared to conventional spray drying and freeze drying, ultrasound-assisted spray drying offered superior overall performance with higher industrial feasibility. From an application perspective, this approach provides a cost-effective, non-thermal, and environmentally friendly solution for producing high-quality whey protein powders suitable for use in functional foods, beverages, and protein-enriched formulations. The findings support the industrial potential of ultrasound technology as pretreatment step for optimizing whey protein powder production.

Abstract Introduction: Essential oils and secondary metabolites of plants have too many uses in medicine as well as food and hygiene industries. The herbal essential oils include different health features including antioxidant and antibacterial activities. Several forms of the activated oxygen, also known as reactive oxygen species (ROS), include free radicals and non-free radical species. In traditional Iranian medicine, coriander seeds are widely used to treat the disease. The objectives of this paper were to identify the chemical compounds and to measure the phenol content and the antioxidant potential of coriander seed essential oil in addition to its free radical scavenging activity. The other aim of this work was to investigate the antimicrobial of coriander seed essential oil on Bacillus cereus, Salmonella typhi, Escherichia coli and Pseudomonas aeruginosa “in vitro”.
 
Materials and methods: In this research, the coriander seed essential oil (100 g) was extraction using water-distillation method with clevenger apparatus. Afterwards, coriander seed essential oil was collected in vials which had already been weighed by a 0.0001 balance and stored at 4 °C until testing. Chemical composition of coriander seed essential oil was determined using gas chromatography. The antioxidant activity was determined by 2,2’-azinobis (3-ethylbenzothiazoline-6-sulphonic acid) di-ammonium salt (ABTS) and 2,2-diphenyl-1-picrylhydrazyl (DPPH) radicles, respectively. The method of Folin-Ciocalteu was performed through determination of TPC. The result was reported as mg of gallic acid/g of the dried coriander seed essential oil. The antioxidant potential of the essential oil was compared with BHA synthetic antioxidant at a concentration of 100 μg/ml. Antibacterial activity of coriander essential oil was determined by disc diffusion agar (Kirby-Bauer test), minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) methods.
 
Results and discussion: Based on the results of chemical analysis, the coriander seed essential oil was rich in oxygenated monoterpenes (89.94%). The main compound of coriander seed essential oil was Linalool (76.75%). The highest percentage of free radical scavenging for DPPH was 53.5% and for ABTS 66.6% at 900 ppm concentration. The total phenol content essential oil was 38.04 ± 0.02 mg GAE/g. The result show that, the most sensitive and the most resistant bacteria with diameter inhibition zone 30.30 mm and 23.15 mm were Bacillus cereus and Salmonella typhi respectively. MIC of coriander seed essential oil for Bacillus cereus, Salmonella typhi, Escherichia coli and Pseudomonas aeruginosa was 2, 4, 4 and 4 mg/ml respectively. MBC of coriander seed essential oil for Bacillus cereus, Salmonella typhi, Escherichia coli and Pseudomonas aeruginosa was 512, > 512, > 512 and 512 mg/ml respectively. In general, the results indicated that the coriander seed essential oil was effective on microorganisms; nevertheless, the extent of its effectiveness varied depending on the type of microorganism. The gram-positive bacteria are more sensitive to essential oil rather than gram-negative ones. The higher resistance of gram-negative bacteria to the essential oils of medicinal plants could be attributed to the more complex structure of the cell membrane of these bacteria compared with the single layer structure of the gram-positive ones. The results of this study revealed that coriander seed essential oil had less antioxidant activity than synthetic antioxidant BHA. Antibacterial activity of the essential oil was higher than the gentamicin antibiotic. Regarding the chemical compositions identified in the coriander seed essential oil, these compositions could be employed as an important economical source uses in medicine as we as food and hygiene industries.

Abstract Introduction
Introduction: Mayonnaise is one types of sauces that has always been loved and preferred by consumers because of its unique texture and taste. Sauce is a semi-solid or liquid food ingredients that consists of emulsifying edible vegetable oils (at least 66%) in a liquid phase including vinegar, water, lemon juice, and egg yolk (Bortnowska and Makiewiewicz, 2006). According to the National Standard of Iran (No. 2454), if the amount of fat in mayonnaise is reduced by at least 25% (from 66% of fat), it is considered reduced fat mayonnaise, and if it is reduced by 50% in fat, mayonnaise is considered low-fat. (National Standard of Iran 2454, 1394). Fibers are edible parts of plants or similar carbohydrates that cannot be absorbed in the gut and only irritate the gut. Dietary fiber contains polysaccharides, oligosaccharides, lignin and related plant materials. Dietary fiber intake can reduce the risk of cardiovascular disease, high blood pressure, diabetes, obesity, cancer and some gastrointestinal disorders. They can alter tissue properties, eliminate hydration, stabilize high-fat foods and emulsions, and improve shelf life (Zhang et al., 2017). Barley (Avena sativa L.) is an important crop with about 21 million tons annually production worldwide. The seed has been used to raise public awareness about the health benefits of beta-glucan, which helps lower blood cholesterol and glucose levels. Protein is the second most abundant element (12 to 20%) in barley after starch, which contains organic amino acids, due to its high lysine content because globulins make up 70 to 80% of total barley protein. Alcohol-soluble prolamins, on the other hand, are the main storage proteins in other cereals (Nito et al., 2015).
 
Materials and Methods
 In this study, nitrate, ethanol, methanol, chloroform, ethylene glycol and acetic acid were prepared from Merck Company (Germany) and sunflower oil from Rana Company, vinegar from Somayeh Company, salt from Aali Company, sugar from Pardis Company, mustard from Bijan Company and Barley Malt Pulp was prepared from Behnoosh Company. Chemical extraction method was used to extract fiber. (Salehifar and Fadai Noghani, 2013). To prepare the mayonnaise samples, the powder ingredients including salt, mustard and sugar, vinegar and water were first mixed well and uniformly with a mixer (IKA WERK, Germany). Then, according to the formulation, the fiber extracted from barley malt pulp was gradually added to the above mixture, which was stirring, and the eggs were added to the mixture and mixed thoroughly to obtain a uniform composition. At this stage, the oil was added dropwise with continuous pouring. Finally, the samples of mayonnaise prepared were kept at refrigerator for further analysis. In all samples, the amount of sugar (11.5 g), white vinegar (23.1 g), eggs (39.45 g), salt (4.50 g), water (24.6 g) was constant (Bostani et al., 2011). In this study, in order to reduce the amount of oil, it was replaced with fiber extracted from barley malt pulp at five levels of 0, 5, 10, 15 and 20% (w / w).
 
 
Results and Discussion
 The effect of replacing different percentages of fibers extracted from barley malt pulp with fat at levels (5, 10, 15 and 20%) on physicochemical properties (fat, fiber, ash, viscosity and colorimetry (L*) a*, b*) and sensory characteristics (taste, smell, color, texture and general acceptance) were determined using analysis of variance at 5% probability level. Various properties of low-fat mayonnaise showed that as the percentage of barley malt fiber increased, the amount of fat, radiance and yellowness in low-fat mayonnaise treatments (P <0.05) decreased, and the addition of fiber increases the viscosity, fiber, ash and redness of mayonnaise, treatments (P> 0.05) as well as protein content. In the treatments, which was statistically significant (P> 0.05), the results of sensory evaluation of mayonnaise samples showed that the addition of fiber extracted from barley malt pulp resulted in a significant reduction in taste, texture, color and the general acceptance of mayonnaise samples (P <0.05), while the decrease in odor score was not statistically significant (P> 0.05), so that the treatment containing 20% barley malt fiber had the lowest sensory score (taste). Smell, texture, color, acceptance k Li) and treatments containing 5 and 10% barley malt fiber received the highest sensory scores (taste, odor, texture, color, general acceptance) from the panelists.
 
Conclusion
 According to the results, treatment 3 (containing 10% barley malt fiber) was introduced as the best treatment in the present study.

Abstract Introduction: Antioxidants by Quenching free radicals and preventing lipid oxidation, retard spoilage, discoloration and rancidity of foods. Due to adverse effects of synthetic antioxidants such as carcinogenicity and liver injury, consumers’ attention toward natural antioxidants are increasing. Turmeric (Curcuma longa) is a medicinal plant frequently used in food industry and pharmacology. In this research, chemical composition, structure and type of bond, antioxidant capacity, total phenol, flavonoid and cytotoxic effect of Turmeric essential oil (TEO) on colorectal cancer cells (HT29) were investigated.
 
Materials and methods: TEO was extracted using Clevenger apparatus by aqueous distillation method. To identify chemical composition, 1 µl essential oil was injected in gas chromatography-mass spectrometry and essential oil composition and quantity were determined by comparing with standards. Functional groups and qualitative identification of turmeric essential oil were done using Fourier-transform infrared spectroscopy (FTIR) in range of 500 – 4000 cm^-1. Antioxidant capacity of TEO was determined suing ABTS, DPPH and β-carotene/linoleic acid bleaching assay. Total phenol and flavonoid were measured by colorimetric methods. MTT test was used to find cytotoxic concentrations of TEO on colorectal cancer cell line (HT29).
 
Results and discussion: The 18 compounds identified in TEO accounted for 97.91% and the highest compound was turmerone by 40%. The other compounds were curlone, zingiberene and benzene with 34, 8.30 and 4.18% respectively. Infrared spectrum in range of 3600-3400 cm^-1 (specially 3516 cm^-1) and peaks at 2930, 1621, 1515 and 1447 cm^-1 were due to stretching vibration of O-H, C-H, C=O, C=C bonds of aromatic ring and aromatic groups of curcuminoids. 1515 cm^-1 peak was due to stretching vibration of C=O bond of sesquiterpenes (turmerone). Observed peaks at 1378 and 1308 cm^-1 confirmed the presence of alkanes or bending vibrations of CH₃ groups in curcuminoids (curcumin). Antioxidant potential of TEO according to DPPH and ABTS methods and β-carotene bleaching assay was 25.15, 93.90 and 72.76 %, respectively. Total phenol and flavonoid content of TEO were 38.91 mg GAE/g and 87.9 mg QE/g. The results showed that by increasing essential oil concentration from 3.125 to 200 mg/mL survival rate of HT29 changed from 66.76 to 9.88%.

Abstract Introduction Raw sugar beet juice (RSBJ) is an intermediate of sugar beet processing obtaining by diffusion process. The RSBJ contains approximately 85% water, 13% sucrose, and 2% non-sugar compounds (impurities) and its purity ranges from 85 to 88%. Due to the low purity, the RSBJ should be subjected to purification process. The conventional purification occurs in a complex multistage process including pre-liming, main liming, first carbonation, and second carbonation. In liming step, lime milk (Ca(OH)2) is added to destabilize and precipitate the non-sugar compounds. Then the CO2 gas is added to precipitate the lime (as calcium carbonate). Although the application of lime is very well known but some impurities, including phenolic compounds, saponins, proteins and lipids pass through purification processing into the white sugar and cause serious difficulties. Due to the variety of compounds (dissolved or suspended) present in RSBJ and this fact that different processes may remove different types of compounds, various fining agents are required to clarification of raw juices. Bentonite, silica sol, gelatin and activated carbon are four types of natural adsorbents, which have been used in many applications, in different fields and processes, including the food industry. Differences in the nature of ionic charges of juice compounds and the fining agents induce neutralization, and flocculation and result in the removal of them from the juice. Therefore, the purpose of this study was to investigate the efficiency of bentonite, silica sol, gelatin and activated carbon in the removal of impurities (protein, saponin and phenolic compounds) causing floc in acidic beverage and improving the purification indexes of RSBJ (turbidity, color, ash and purity). Floc refers to the cloudy and turbid precipitate that forms in some sugar-sweetened carbonated soft drinks after standing for several days. While flocs are harmless, they are a visible defect and consumers don’t accept the soft drink product for aesthetic reasons. Currently, most researchers assume that saponins are primarily responsible for floc formation. However, there are some studies indicating that protein, phenolic compounds and lipids also play a role in floc formation.  Materials and methods: The RSBJ was regularly obtained from the sugar factory of Piranshahr, Iran. The RSBJ was sampled at the point just before the purification step and immediately transferred to the lab. Fining agents used for clarification including bentonite (Na–Ca Bentonite ERBSLÖH, Geisenheim, Germany), silica sol 15% (Baykisol 15%), Gelatin (type-A; 100 bloom, Erbigel, Germany) and activated carbon (CS-2000, Gostar Ghoumes CO. Iran) was provided by Azar kam Co. Urmia. Iran. For each experiment, 200 ml of the raw juice was subjected to various refining treatments. The RSBJ were refined at 75 °C for 100 min by fining agents. Fining agents were added to beet juice samples according to the preliminary experiments. After the completion of the clarifying process, juice samples were passed through a microfilter (45 µm) to removing formed floc. In order to compare the mentioned treatments (bentonite, silica sol, gelatin and activated carbon) with the conventional method, the RSBJ was also treated with lime-carbon dioxide in four stages (pre-liming (15 minutes at 85 ° C), main liming (15 min at 88 ° C), first carbonation (up to pH 11, 90 ° C) and second carbonation (up to pH 9, 92 ° C)). After applying the treatments, purity and ash content (by conductimetry method) was measured as the main purification indexes for assessing the quality of the juice samples. The total protein (by dye-binding method), total phenolic compound (by Folin-Ciocalteu reagent) and total saponin content (by vanillin-sulfuric acid method) was also determined as the compounds have a key role in formation of acid beverage floc.  Results and discussion: In this study, four refining agents of bentonite, silica sol, gelatin and activated carbon were used to improve the purification indexes of RSBJ and to remove non-sugar impurities causing floc in acidic beverage (such as carbonated beverages). Based on the ash and purity, it was showed that the applied adsorbents (bentonite, silica, gelatin and active charcoal) significantly improved the purification indexes of RSBJ. The results also showed that the ability of bentonite as a negative charged adsorbent was considerably higher than silica-sol in removing impurities (protein, saponin and phenolic compounds) causing floc, and improving the purification indexes (turbidity, color, ash and purity). So, the bentonite treatment reduced protein, phenolic compounds and saponin content of juice by 68, 61 and 40 %, respectively. The combination of gelatin and activated carbon as supplemental clarifiers with bentonite and silica also improved the parameters measured. In general, Bentonite-Activated carbon treatment had the best results, resulting in a reduction of 73, 87 and 85 % in protein, phenolic compounds and saponin, respectively. In this study, mentioned treatments were also compared with conventional treatment (lime-carbon dioxide) and it was observed that new treatments can be a good choice to combine or replace with conventional treatment.

Abstract Introduction: Study in order to introduce new antimicrobial agents with natural origin to prevent the antibiotic resistance and eliminating its effects, employing chemical agents is an indispensable necessity. Honey, as an important food with natural origin has high antimicrobial potential. Several factors have contributed to the antibacterial activity of honey. For example, acidity, osmolarity, hydrogen peroxide, phenolic and flavonoid compounds, including these factors. Also, small amounts of glucose oxidase, protease, amylase, catalase and phosphatase enzymes and chemical compounds such as methylglyoxal are also effective. Floral origin of honey is effective on its biological properties including antimicrobial, anti-tumor, anti-inflammatory, antioxidant and antiviral activity. So this study was done to evaluate the antibacterial activity and physico-chemical analysis of four types of honey with different floral origin including: Thyme, Eryngium, Pennyroyal and Dill collected from the bee hives in Golestan province. Materials and methods: Four honey samples with different floral origin including, Thyme, Eryngium, Pennyroyal and Dill were collected from the bee hive in the Golestan province in north of Iran. The bacterial strains used in this study, including two species of gram-negative of Escherichia coli and Shigella dysenteriae and the two species of gram-positive of Staphylococcus aureus and Bacillus cereus were provided in lyophilized. Bacterial strains in BHI broth were activated and from each of them were prepared bacterial suspensions equivalent to the McFarland 0.5 turbidity standard (1.5×108 CFU/ml). Evaluation of antibacterial activity using agar well diffusion method was performed. For this purpose serial dilutions of honey samples were prepared aseptically in sterilized distilled water. Surface of Mueller Hinton agar were uniformly inoculated with bacterial suspension containing of 1.5×108 CFU/ml. Then wells of 8 mm in diameter were prepared and these wells were filled with different dilutions of honey samples. After incubation at 37°C for 24 h, antibacterial activity was analyzed by measuring the zones of inhibition. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of honey samples were determined by using broth macro-dilution method. For this purpose, each of the tubes from different dilutions of honey samples were added by 5×105 CFU/ml from each of the tested bacteria and incubated for 24 h at 37°C. The results for microbial turbidity of visible were recorded. The last dilution (lowest concentration) in which microbial turbidity was not observed, as the MIC was considered. For the determination of MBC, from the tube that contained honey concentrations higher than the MIC were cultured onto the agar medium. The MBC was defined as the lowest concentration that allowed no visible growth on the agar. Also the studied physico-chemical properties were moisture content, pH, acidity, ash content and reducing sugars that was performed according to the Iranian National Standard No. 92. Results and Discussion: The results indicated that the antibacterial effects of the tested honeys, and the difference between floral origins honeys is effective in antibacterial properties. MIC and MBC values obtained for the tested honeys were in the range of %6.25-50% (vol/vol). Highest antibacterial activity was recorded for Eryngium honey by agar well diffusion method with zone of inhibition of 15.5, 14,11 and 11 mm against S. dysenteriae, S. aureus, B. cereus and E. coli at concentration of 50% v/v respectively and its MIC for this bacteria were, 6.25%, 10%, 10% and 25% respectively. also low antibacterial activity of Pennyroyal honey was confirmed so that MIC of the this honey for E. coli, S. aureus, B. cereus and S.dysenteriae was, 50%, 25%, 12.5% and 10%, respectively. The quality of honey depends on a number of physico-chemical properties such as moisture, ash content, pH, acidity, the amount of sugars. For this reason, standards for honey have been set by different countries. The physico-chemical analysis of honeys showed moisture contents in the range of 22.56-25.36%, acidity in the range of 12.58-13.59 meq/kg, pH in the range of 4.15-4.26, reducing sugars in the range of 63.7-63.8%. Also the ash content of Eryngium honey with 0.183% was higher than the other honey samples. This higher level might be due to the higher pollen count in this region. High ash contents may also depend upon the floral origin of honey and the material collected by bees during foraging. The low acidity of honey samples studied in the present study was due to the fact that there was no unwanted fermentation in these samples. Overall, the results implied that honey samples with different floral origin collected from the bee hive in the Golestan province in north of Iran have variable potential antibacterial activity. The variety of antibacterial effects of different types of honey can be due to differences in plants that honey is obtained from. In other words, different species of plants in different regions have different compounds and their obtained honey will not be the similar and thus its biological effects also will be different.

Abstract Introduction: Banana is one of the most consumed fruit in the world and is cultivated almost in all tropical countries. This fruit has a high nutritional value and is a suitable source of energy due to the presence of high amount of starch, sugar, vitamin A and C, potassium, sodium, and magnesium. Banana is highly vulnerable after harvesting and is subject to the microbial spoilage due to the high moisture content which makes difficult its sales and exports. Therefore, several methods have been used to overcome these problems. Drying and dehydration are methods to extend the shelf life of banana which usually carries out by hot air. This method can prevent some degree of microbial spoilage, but it has some disadvantages such as changing color, taste, flavor and reducing the nutritional value. Foam-mat drying as a substitute for hot air drying introduces some advantages such as using the microwave energy. In this method, food products are whipped to form stable form and then dehydrated by thermal means. Due to the larger surface area and accelerated moisture transfer from foam, food products can be dried at lower temperature and time by this method of drying. Moreover, the porous structure of dried foam results in a faster rehydration and solubility of dried food samples. Additionally, microwave-assisted drying results in a product with better quality because of faster rate and saving energy. Materials and methods: The fresh banana was cut into small pieces with a diameter of 1.0 mm after peeling. To prevent the enzymatic browning of samples, blanching was carried out by boiling water (100 °C) for 3 min. After that, the banana cuts were placed in a container containing 10°C water in order to cool. To produce pulps, the homemade Bosch mixer (model w600, CNSM, 30EW, Slovenia) at a speed of 1500 rpm and 1.0 min was used. Then, the pulps were mixed with skim milk at different concentrations (3-6 % w/w) and homogenized by ultra-turrax (IKA® Labortechnik) at 10000 rpm for 5.0 min. Moreover; the prepared xanthan gum was added to the mixture at concentrations of 0.15 and 0.25%. Xanthan gum was prepared by adding 1.0 g gum into 100 mL water and mixing by magnet stirrer. Afterwards, the gum solution was kept overnight at 4 °C for complete hydration. Finally, the sample transferred into the foam-maker device which was connected to a nitrogen gas tank with different flow rate (0.2-2 L min-1). The speed and time were adjusted to 16000 rpm and 5.0 min, respectively. After the producing of banana milk foam and selecting optimum sample based on the lowest density and the highest stability, the drying kinetic of this sample was studied. Then the banana milk foam was dried using microwave (360, 660 and 900 V) in a glass plate with diameter of 3.0 and 5.0 mm. Foam density and stability were determined by the methods of Xian-Zheetal (2010), Stauffer (1999) and Bag et al. (2010). The color of samples was studied by hunterlab. Moisture content also was measured based on the AACC standard method (AACC, 2000). Glass transition temperature also was determined by differential scanning calorimetry (DSC, model OIT-500 Sanaf Electronics Co, Iran). Results and Discussion: In the present study, foam-mat method and microwave drying were used to reduce the drying damages. Nitrogen gas and xanthan gum also were used respectively to control foam generation and improve the stability of foams. Optimization of the banana milk production was carried out using response surface methodology based on three variables including the rate of nitrogen gas (0.2-2 L min-1), concentration of xanthan gum (0.15-0.25 %) and milk to banana ratio (1:6 and 1:3). Optimization was done based on the highest stability and lowest foam density. The optimum condition was proposed as the nitrogen gas rate of 0.2 L min-1, xanthan gum of 0.22 % and 3% banana which showed the density of 0.39 and the highest stability (0 mL after 1.0 h). After that, the optimum sample was dried by microwave. The effects of three levels of microwave voltage (360, 660 and 900 V) and two diameters (3 and 5 mm) were evaluated for drying of optimum sample. The results showed that the sample dried with diameter of 3 mm and voltage of 900 V had the highest L*, highest glass transition temperature and the lowest moisture content.

Abstract Introduction: Microbil transglutaminase (MTG, E.C. 2.3.2.13) is a transferase enzyme that catalyses the acyl transfer reaction between -carboxyamide groups of peptide-bound glutamine residues and the primary amino groups including -amino groups of lysine residues. This will lead to the formation of new intra- and intermolecular crosslinks between proteins in order to formation of polymers with high molecular weight. Such crosslinks can modify the structure and functionality of proteins. Actually, crosslinking of milk proteins caused by enzyme leads to improvement in functional characteristics of proteins and formation of products with desirable sensory and rheological properties. Nowadays enzymatic cross-linking is widely used to improve the functional properties of proteins. Because undesirable side reactions that could lead to produce of toxic co-products by chemical modification may be minimized by enzyme catalysis. In last twenty years, consumer trends towards low or non-fat dairy products especially nonfat yoghurt have increased because of harmful effects of excess fat on human health. However, many consumers prefer low-fat products with a similar sensory quality to full-fat ones. The traditional methods used to improve yoghurt texture and decrease syneresis include the enrichment of dry matter (total solids) and/or protein content, as well as the addition of natural or synthetic gums. The polymerization of milk protein chains by transglutaminase for three-dimensional net stabilization in yoghurt provides new technology to prevent common problems in dairy product processing. In this study, the effect of microbial transglutaminase concentration, incorporation amount of sodium caseinate into milk and storage time on proteolysis, rheological properties and water holding capacity of nonfat stirred yoghurt was investigated using response surface method (RSM).
Materials and methods: Twenty treatments were carried out according to a face-central composite design with three factors and three levels for each variable. The independent variables of the design were Enzyme concentration, amount of sodium caseinate and storage time. They were in the range of 0-2 Unit per gram of milk protein, 0-1.27 percent and 1-19 days, respectively. For preparation of samples, first of all the SNF and protein content of milk were fortified by addition of skim milk powder and sodium caseinate. The milk was tempered to 50°C in a water bath and subsequently transglutaminase was added at different concentration. It was incubated for 1 hour at 50°C in the water bath. Then it was pasteurized at 85°C for 15 min to inactive the enzymatic reaction and cooled to 45°C. After inoculation with the appropriate inoculum type according to the commercial recommendation, incubated at 42°C until the pH value of 4.6 was obtained. The yogurt samples were cooled in ice-water bath and stirred for 60 second using manual stirrer. Samples were distributed into sterilized plastic containers; they were sealed and stored at 4°C until examined. Characteristics of all yoghurt samples were evaluated, such as: proteolysis by using o-pthaldialdehyde (OPA) assay, apparent viscosity by Brookfield viscometer and water holding capacity. Proteolysis was carried on 3 steps including preparation of yoghurt water extracts, preparation of OPA reagent and absorbance measurements. Briefly, 150 µl of yogurt serum was added directly to 3 ml of OPA reagent in a 5 mL quartz cuvette and the solutions were mixed briefly by inversion prior to 2 min incubation at room temperature followed by absorbance measurement at 340 nm.
Results and discussion: The statistical analysis of results showed that increase in enzyme concentration increased viscosity and water holding capacity of samples and decreased the proteolysis (p≤0.05). The presence of transglutaminase contributed to an increase in the viscosity due to its ability to form high molecular weight polymers from protein monomers. Crosslinking of protein chains stabilized the three-dimensional network of yoghurt gel and prevented yoghurt whey expulsion as a result of a decrease in gel permeability; thus, increasing water holding capacity. The lesser proteolytic activity with using transglutaminase may be explained by a combination of these two factors: 1) transglutaminase-induced cross-linked milk proteins were less suitable substrates for proteolytic enzymes in starter culture than native milk proteins and, 2) Proteolytic products such as peptides were crosslinked into the milk proteins by transglutaminase. It is known that the yoghurt may become too acidic and bitter due to excessive acidification and proteolysis even at refrigerator temperatures. The development of these defects generally determines the shelf life. Our results indicate that it may be possible to produce yoghurts with longer shelf life when using transglutaminase. Addition of sodium caseinate resulted in the increased viscosity and water holding capacity of samples. Also, during the storage period, water holding capacity was decreased and proteolysis of samples was significantly increased (p≤0.05).
Conclusion: The optimum conditions for the production of yoghurt was obtained using 1.42 Unit enzyme per gram of milk protein, 0.47 percent sodium caseinate with a storage period of 15 days. The overall desirability value was equal to 0.83. Under these conditions the predicted percentage of water holding capacity, viscosity and proteolysis being 27.51, 5220 cp and the absorbance at 340nm was 0.349 nm (as proteolysis index), respectively

Abstract The present research surveyed the effect of five factors including: microwaves power, air temperatures and its flow rates, microwaving time onset and amount of substances on the requested time and energy for combined fluidized bed- microwaves drying of black raspberry into 50% dry base wet content. Response surface methodology and Central composite was used as experimental design. Multiple linear regression was used for obtaining second polynomials models for each analyses followed by ANOVA analysis in order to confirming the adequacy and accuracy of resulted models. Using the empirical resulted model the relationship between variables and responses were determined via response surface method. Correlation coefficients of the regression models were 0.964 and 0.970 respectively for the drying time and energy consumption. The Optimized drying condition were including; 600 watts for microwaves power and microwaving onset from that time as the moisture content was 344% decreased,73 g for amount of substances, and 85˚C and 15 m.s-1 for air temperatures and its flow rates respectively. Under mentioned conditions, the fitted model was predicted 52.66 Min and 65.2 Kj respectively for the requested drying time and energy consumption at combined drier. As a conclusion, the results showed that requested drying time and energy consumption were decreased with increasing of temperatures, microwaving time and its power, and decreasing of air flow rates. In this regard, the drying kinetics curve samples were drawn under the conditions listed that showed drying time is reduced to 76% with increasing temperature from 55 to 85 and use the microwave reduced drying time until 30 to 80%.

Abstract Fatty acid modified cellulose nanofibers (MCNFs) and TBHQ antioxidant were added to poly(lactic acid) (PLA) film. The combined effects of the MCNFs and TBHQ on the morphological, thermal, mechanical and barrier properties of PLA film were analyzed. The morphology of fracture surfaces evaluated by field emission scanning electron microscopy (FE-SEM). XRD results showed that the crystallinity of the PLA film with added MCNFs was substantially higher than that of pure PLA and antioxidant active PLA films. Glass transition and melting temperatures changed with the addition of these two components. The addition of 3wt% of TBHQ to PLA films leads to a significant reduction (p

Abstract Introduction: Nowadays, one of the most important nutritional problems in different societies is the protein mal-nutrition. Since bread is the main food material being consumed in all over the world, bread enrichment using the grains rich in protein such as sesame seeds would be an appropriate alternative. However, addition of sesame products such as Tahini meal would cause some technical difficulties such as dough stability, water absorption, dough extension time, etc. in bread manufacturing processes.In this study the effect of addition of xanthan gum to on physical and textural properties of Baguette bread containing tahini meal was investigated.
Materials and methods: Wheat flour and tahini meal were supplied from Damghan and Ardakan cities, respectively. They were then refrigerated prior to baking process and different chemical tests were carried out according to standard methods. Protein was measured based on Kejeldahl method. Moisture content as well as ash content were determined using oven method.Raw fat was calculated according to AACC-No. 30-10 and raw fiber was measured using appropriate instrument (Scientific velp-FIWE6 F30530201). Starch determination was carried out using Small universal polarimeter (SUP-Germany). Xanthan gum was purchased from Provisco Ltd. (Switzerland) in food grade quality. Bread yeast (Saccharomyces cerevisiae) was also supplied in dried form. All other chemical enhancers were purchased from Merck Ltd. (Germany). Baguette dough was produced from mixture of wheat and Tahini meal flour based on protein content and the amount of protein in final dough was increased from 10.28% in flour free of tahini meal to 12, 14 and 16% in different treatments. The rest time for all flour samples was fixed at 15 min and the baking process was carried out for 15 min at 300°C. Baked breads were exposed to room temperature for two hours and then were packed using poly-ethylene (PE) film for further tests. Specific volume of bread samples was measured using rapeseed displacement method (AACC, No. 54-30, 2000). Samples porosity was determined using image processing techniques. Samples were cut to 2cm×2cmcubes and an appropriate scanner (Canoscan 8800F, Japan) with 300 pixel resolution was used to acquire the images for further process using Image J(1.6r, 2010). Apparent color for the baguette samples (in terms of CIE ‘L*’- lightness,“a*” - redness and greenness, and “b*”- yellowness and blueness) were also measured using image processing techniques (Image J, 1.6r, 2010).Texture profile analysis (TPA) test was carried out using a texture analyzer (QTS Texture Analyzer, CNS Farnell, Hertfordshire, UK) to study the effect of xanthan gum and tahini meal on parameters such as hardness, gumminess and cohesiveness in all baguette samples.
Results and discussion: ANOVA test showed the significant effect of xanthan gum and tahini meal on the porosity of samples. The porosity of samples containing less than 0.5% xanthan gum at all tahini meal levels, was significantly less than control sample.Similar results were obtained in the case of specific volume meaning that the employed treatments have significant effect on bread’s specific volume. Increasing tahini meal from 9.45% to 14.53% caused significant decrease in specific volume. This could be due to the weakness of dough gluten matrix. These results are in agreement with other works reported by other researchers (Paraskevopoulouet al., 2010; Mohammad Idrisset al., 2012; and Guardaet al., 2004). The results obtained for apparent color of bread core also showed the effect of xanthan and tahini meal. The only exception was found in case of a* value when studying the effect of xanthan gum, meaning that xanthan gum has no significant effect of this parameter. In the case of apparent color in bread crust, the studied treatments (xanthan gum and tahini meal) showed significant effect on all color parameters. Different textural properties of baguette samples including hardness, gumminess and cohesiveness were also measured.
Conclusion: The results indicated obvious effect of xanthan gum and tahini meal levels on these mentioned parameters. Increasing tahini meal and xanthan gum levels would increase hardness as well as gumminess. However, addition of xanthan gum and tahini meal cause significant decrease in cohesiveness. This could be due to dilution effect of these substances which decrease the concentration of protein matrix existed in flour’s gluten.

Abstract Introduction: Meat and meat products undergo chemical and microbial spoilage during production, transportation, storage and consumption. Antimicrobial edible coatings containing natural herbal extracts and essential oil possess various benefits and are currently used to design novel active biodegradable packaging. Natural polysaccharides are considered as potentially good candidates to fabricate edible coatings and provide a shelf life extender. There are no researches in the literature concerning the potential effect of Carum copticum essential oil (CCEO) enriched Scutellaria lateriflora seed mucilage (SLSM) based edible coatings on the quality and shelf life of lamb during refrigeration storage. The objective of this study was therefore to investigate the inhibitory effect of CCEO loaded SLSM edible coating towards lipid oxidation and microbial spoilage of lamb during cold storage conditions.
 
Materials and methods: In this study, SLSM was extracted from whole seeds using hot-water extraction. Edible coating was prepared by dissolving 2 g of the extracted SLSM and 0.1 g of Tween 80 in 100 mL of sterilized distilled water. The mixture was stirred and heated for 2 h. Afterwards, CCEO was added to the SLSM solution at 0, 1, 1.5, and 2%, and the obtained solution was used as an antimicrobial coating for extending the shelf-life of lamb slices. The control and the coated lamb samples were analyzed periodically for microbiological (total viable count, psychrotrophic count, Escherichia coli, Staphylococcus aureus and fungi), chemical (peroxide value and pH), and sensory characteristics (color, odor and overall acceptability).
 
Results and discussion: SLSM extended the microbial shelf life of lamb by 3 days, whereas SLSM + 1% CCEO, SLSM + 1.5% CCEO and SLSM + 2% CCEO resulted in a significant shelf life extension of the lamb by 6, 6, and 6 days, respectively as compared to the control samples. The results demonstrate that the EO-rich edible coating functions as an oxygen barrier and, in turn, limits the growth of most important and aerobic psychrotrophic bacteria, i.e. Pseudomonas species, which are mainly responsible for the fresh lamb spoilage under aerobic conditions. The results showed that the pH of lamb coated with SLSM and samples containing CCEO was lower than the control. The results showed that the peroxide value in the control sample increased from 0.4 to 9.7 meq oxygen/kg during 9 days of refrigerated storage. Based on the finding of this study, the use of CCEO-loaded coating manifestly lowered the meat lipid oxidation. The resultant edible coating manifestly improved the shelf life of lamb through suppressing microbial spoilage and inhibiting lipid oxidation. The coating containing 2% CCEO conferred good quality characteristics to the lamb and expanded its refrigeration shelf life.

Abstract  Introduction
Gastrointestinal diseases are very important among human societies, especially in developing countries. Celiac disease is one of these diseases, caused by the interference of gluten in food, the body's immune system, genetics and environmental factors. Therefore, it is necessary to provide a solution for the production of gluten-free products and also to improve their quality. The tremendous growth in the nutritional knowledge of the public has caused the development and production of healthy food products for certain groups. Baked products such as cookies are very popular among the society because of their textural characteristics as well as flavoring and attractive colors. Therefore, their enrichment is of interest. Most commercial gluten-free bakery products are based on pure starch or the combination of corn starch with gluten-free flour, which is associated with dryness and sandiness in the product.
 
Materials and Methods
The aim of this research was to investigate the functional characteristics of non-extruded and extruded chickpea flour samples and then the effect of adding different levels of it (0, 20 and 40%) on physicochemical, Lightness, porosity and sensory characteristics using completely randomized factorial design. The blend of chick pea flour- xanthan gum was extruded by a parallel twin-screw extruder (Jinan Saxin, China). Process was performed with die of 3 mm, and extrusion temperature of 140 ℃. The chemical composition of raw materials was measured by standard AOAC (2000) methods. The hardness of cookies was measured using Texture Analyzer (TA plus Ametek, UK). The cylinder steel probe (2 mm diameter) was set to move at a speed of 1 mm/s. Samples were punctured by the probe to a distance of 10 mm. The color values of L* (lightness), a*(redness), b*(yellowness) of the samples were determined by the Hunterlab instrument (Reston VA, US) (Rhee et al., 2004). Water absorption index in terms of grams of bonded water was calculated per gram of dry material in percent. Sensory evaluation was performed using a 5-point hedonic test.
 
Results and Discussion
In general, gluten-free products are unable to maintain carbon dioxide gas due to the lack of a coherent and uniform gluten network, which causes an increase in volume. As a result, the product is small in volume and the structure of the crumb is compressed. The extrusion baking process had a high potential to improve cookie quality. In such a way that the addition of extruded chickpea flour increased the porosity of the cookie samples. The results of the texture analysis show that the addition of extruded chickpeas up to a 40% improved the texture of the cookie and also increased its shelf life. Also, the sensory test results showed that the favorable effect of adding extruded chickpea flour up to 20%. Consequently, by summarizing the results of physical and sensory tests, it was determined that cookies with appropriate sensory and quality characteristics can be produced using 40% of extruded chickpea flour. Peas, and especially extruded peas, rich in protein and dietary fiber content and high water absorption ability, led to increase the moisture and reduced the hardness of the cookie texture. Considering the increase in demand for gluten-free products, it seems that enriching these products with nutrients such as chickpea flour can be an alternative method to improve the nutritional value of these products. Adding legumes is a good way to increase the consumption of legumes, which are rich in the amino acid lysine. Legumes, especially peas, have high nutritional value and functional characteristics, and including them in the diet by adding them to bakery products is a good way to increase their consumption. The use of chickpea flour as a nutrient source in cookie formulation increases the nutritional value, reduces the glycemic index and improves the variety of such products.







 




 

Abstract Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields which, when they interact with electromagnetic resonance radiation, their radiant properties rises sharply. This process causes the absorption process of these nanoparticles to be several times stronger than the absorption process of the strongest adsorbent molecules and their scattered light is several times more intense than the organic materials fluorescence. These unique properties provide a high potential for these nanoparticles to be used in many applications such as biochemical sensors, biomedical imaging and medical treatments. Aptamers are single-stranded oligonucleotides, DNA, RNA or proprietary proteins that have the ability to attach specifically to their target. The basis for identifying the target by aptamers is the third structure formed by them. One of the important benefits of aptamers to antibodies is their smaller size, which makes them more easily and effectively penetrated. It also has neither toxicity nor immunogenicity unless in very low levels. Therefore, biosensors that use aptamers as biological identifiers are known as aptasensors. In this research, due to the high losses caused by aflatoxins to the crops and their toxicity, the rapid detection of these pesticides by aptasensor method was investigated.
 
Materials and methods: The test was carried out in a 96-well plate and for each concentration three replicates were considered. In each test, 100 μl of the nano gold solution, which was centrifuged twice at 12000 rpm and at room temperature, was thrown into 11 concentrations and three repetitions in the plate houses. Then adding 15 μlit of aptamer at a concentration of 5 μmol plus 10 μlit of distilled ultrapure water to the houses and incubate for 30 minutes at room temperature. After this time, 25 μlit of different concentrations of aflatoxin plus 15 μlit of 2 molar salt solutions and 35 μlit of distilled water were added to the houses and, after mixing (up and down) in the ELISA reader, absorbed it we read.
 
Results and discussions: At first, with adding the aptamer to Nano gold particles a complex between nanoparticles and aptamer is created. But in present of suitable aflatoxin, the complex of nanoparticle and aptamer is separated and a new complex between aflatoxin and nanoparticle is formed. Subsequently the color is changed to purple. This color change is visible to the eye, indicating that the Aptamer is suitable for Target. In this study, it was found that an aptamer with GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA sequence only affects aflatoxin G1 and other aflatoxins such as B1, B2, and G2 should be considered as another sequencer for Aptamer.

Abstract Introduction
 Quinoa, which is known as the mother grain,has higher protein content than common cereals and possesses a large lysine content. Quinoa is composed mainly of carbohydrates (60-75%), of which 10-13% is dietary fiber. Quinoa also has a slightly higher protein content (12-16%) compared with cereal grains and fat content (5-9%) that is rich in unsaturated fatty acids. Quinoa seeds contain similar or slightly higheramounts of bioactive compounds such as polyphenols (2.7-3.8 g/kg). Moreover, quinoa is gluten-free, thus providing the ability to enhance the selection of gluten-free products forconsumers with celiac disease, but this type of characteristicis challenging to development of bakery products from quinoa with desirable physicochemical properties. Processing of cereal grains and pseudo-cereals into products that deliver a nutritive valueto consumers represents a considerable opportunity for large scale food processing. There havebeen some reported studies on roasting, extrusion, steam pre-conditioning and pearling of quinoafor further uses. Extrusion cooking is a promising technology for improvement of functional properties of quinoa flour. The Evaluation of physicochemical properties and microstructure of Expanded quinoa as affected by extrusion conditions was the main goal of this project.
 
Material and Methods
 In this study, a parallel twin-screw extruder (Jinan Saxin, China) with die diameter of 3 mm was applied. The effects of extrusion process parameters including feed moisture content (14 and 16%) and die temperature (130, 150 and 170 °C) on final moisture content, bulk density, water absorption index (WAI), color parametersL* (lightness), a*(redness), b*(yellowness), hardness, and microstructure of Expanded quinoa were studied. Extrusion was carried out using a co-rotating twin screw extruder with L/D ratio of 10:1 and die diameter of 4 mm. The feed rate of flour and the screw speed were set at 40 kg/h and 200 rpm, respectively. The physicochemical properties were measured using standard methods. The hardness measurement was performed by a texture analyzer. The cylinder steel probe (2 mm diameter) was set to move at a speed of 1 mm/s The samples were punctured by the probe to a distance of 10 mm . The color parameters of the samples were determined by the Hunterlab machine. The morphology of samples was assessed using a scanning electron microscopy (SEM).
 
 
 
Results and Discussion
 A comprehensive study on impacts of extrusion processing conditions on quinoa flour was conducted. The effect of process variables on the physicochemical attributes of the extrudates was observed. the expanded quinoa with higher feed moisture content had greater moisture and those extruded at higher die temperatures showed lower moisture content (p<0.05). Moisture can reduce the shear force as a plasticizer and increase the amount of moisture absorption of the product. While increasing the die temperature, the effect of shear force on starch dextrification increases and reduces moisture absorption (p<0.05). WAI was significantly influenced by extrusion variables. In fact, feed moisture content and die temperature both positively changed the WAI of quinoa flour so that all extruded samples had significantly higher WAI than the untreated sample (p<0.05). Moreover, the sample with the higher feed moisture content (24%) treated at the highest extrusion temperature (170 °C) showed the largest and lowest water absorption and Hardness respectively (p<0.05). Another important feature of expanded quinoa is the lightness index, the results revealed that extrusion cooking caused a reduction in L* and enhancements in a* and b*. While changes in color parameters were more pronounced at more severe die temperature, higher feed moisture content counteracted the effects of cooking temperature on the color of the products. As expected from changes in the abovementioned color parameters, the sample with lower feed moisture content (16%) treated at the highest extrusion temperature (170 °C) experienced the greatest color change (ΔE). The texture profile analysis (TPA) indicated that higher feed moisture content yielded extrudates with harder texture whereas, extrusion at higher temperature resulted in lower hardness. The scanning electron micrographs showed that the native quinoa flour encompassed both small- and large-sized starch granules while the extruded sample mainly consisted of disaggregated particles. Furthermore, extrusion cooking of samples with higher feed moisture content caused formation of more uniform starch aggregates with smoother surfaces.