نوع مقاله : مقاله پژوهشی فارسی

نویسندگان

گروه علوم وصنایع غذایی، واحد قوچان، دانشگاه آزاد اسلامی، قوچان، ایران.

چکیده

آفلاتوکسین‌ها سموم قارچی طبیعی هستند که از گونه‌های قارچ آسپرژیلوس مانند آسپرژیلوس فلاووس و آسپرژیلوس پارازیتیکوس نشات می‌گیرند. این سموم اگر از راه مواد خوراکی وارد بدن شوند می‌توانند سرطان‌زا باشند. روش­های تشخیصی متفاوتی برای آفلاتوکسین وجود دارد که زمان­بر و پرهزینه می‌باشد. روش آپتاسنسورهای رنگ‌سنجی به‌وسیله نانو ذرات طلای سوسپانسیون شده در آب، روشی سریع و اختصاصی می‌باشد که با استفاده از یک ملکول شناساگر با درجه انتخابی بالا انجام می‌شود. در این پژوهش آپتامری با توالی GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA برای تشخیص چهار آفلاتوکیسن B1، B2، G1 و G2 استفاده شد. نتایج نشان داد که این آپتامر به‌طور اختصاصی توانایی تشخیص آفلاتوکیسن G1 را داشت به نحوی که هنگام اضافه شدن آفلاتوکسین G1 به محلول حاوی آپتامر و نانوذرات طلا ، آپتامر دچار تغییر ساختار شده و از نانو ذرات طلا جدا می‌شود و جذب آفلاتوکسین می‌گردد. پس از جدا شدن آپتامر، نانوذرات ناپایدار شده بلافاصله تجمع و رسوب داده که منجر به تغییر رنگ از قرمز به بنفش می‌گردند. اما در مورد سایر آفلاتوکسین های مورد بررسی چنین تغییر رنگی مشاهده نشد که نشان‌دهنده آن است که این آپتامر در برابر آن‌ها به تغییر ساختار حساس نیست و اختصاصی عمل نمی‌کند.

کلیدواژه‌ها

Akbari, B Pirhadi Tavandashti, A and Zandrahimi, M. 2011. Particle Size Characterization of Nanoparticles- a Practical Application”, Iranian Journal of Materials Science & Engineering, 8 (2): 48-56.
Alex P. Wacoo, Deborah Wendiro, Peter C. Vuzi, and Joseph F. Hawumba. 2014. Methods for Detection of Aflatoxins in Agricultural Food Crops. Journal of Applied Chemistry Volume 2014, Article ID 706291, 1-15
Amini A., Afzali-Grooh D., Chamsaz M. 2014. Determination of Aflatoxins B1 and B2 in Powdered Milk Using Modified Liquid Chromatography Method, 21 (4): 321-331.
Blank M, Blind M. 2005. Aptamers as tools for target validation. Current Opinion in Chemical Biology. 9(4):336-42.
Chen A, Liu J, Guan Z, LV Z, Jiang X, Yang S. 2014. Improving sensitivity of gold nanoparticle based fluorescence quenching and colorimetric aptasensor by using water resuspended gold nanoparticle. Biosensors and Bioelectronics 52 (15), 265-270.
Davis KA, Abrams B, Lin Y, Jayasena SD. 1996. Use of a high affinity DNA ligand in flow cytometry. Nucleic Acids Research. 24(4):702-6.
El-Sayed M.A. 2001. Some Interesting Properties of Metals Confined in Time and Nanometer Space of Different Shapes. Acc. Chem. Res., 34 (4), pp 257–264.
Freund, P. L., Spiro, M. (1986). J. Chem. Soc., Faraday Trans. 1, 82, 2277.
Gopinath SCB. 2007. Methods developed for SELEX. Analytical and Bioanalytical Chemistry.387(1):171-82.
Hermann T, Patel DJ. 2000. Adaptive recognition by nucleic acid aptamers. Science. ;287(5454):820
Hicke BJ, Stephens AW, Gould T, Chang Y-F, Lynott CK, Heil J, et al. 2006. Tumor Targeting by an Aptamer. J Nucl Med. 2006 1, 47(4):668-78.
Hirsch, L. R., Stafford, R. J., Bankson, J. A., Sershen, S. R., Rivera, B., Rrice, R. E., Hazle, J. D., Halas, N. J. West, J. L. 2003. Nanoshell-mediated near-infrared thermal therapy of tumors under magnetic resonance guidance. Proc. Natl. Acad. Sci, 100(23):13549-54.
Link S and El-Sayed M.A. 1999. Spectral Properties and Relaxation Dynamics of Surface Plasmon Electronic Oscillations in Gold and Silver Nanodots and Nanorods. J. Phys. Chem. B 103, 8410-8426.
Mirkin CA, Letsinger RL, Mucic RC, Storhoff JJ. 1996. A DNA-based method for rationally assembling nanoparticles into macroscopic material. J. Nature, 382(6592):607-9.
Ohuchi SP, Ohtsu T, Nakamura Y. 2006. Selection of RNA aptamers against recombinant transforming growth factor-[beta] type III receptor displayed on cell surface. Biochimie. 88(7): 897-904.
Pan, Y et al, 2007. Size-dependent cytotoxicity of gold nanoparticles. Small, 3 (11): 1941-1949.
Que-Gewirth NS, Sullenger BA. 2007. Gene therapy progress and prospects: RNA aptamers. Gene Therapy, 14(4):283-91.
Shankar, S.S, Rai, A, Ahmad, A. Sastry, M. 2004. Rapid synthesis of Au, Ag and bimetallic Au core-Ag shell nanoparticle using neem (Azadirachtaindica) leaf broth”,Colloid Interface Sci, 2004,275,496-502.
Stoltenburg R, Reinemann C, Strehlitz B. 2007. SELEX--a (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol Eng. [Review]. 24(4):381-403.
Susie Eustis. 2006. Gold and Silver Nanoparticles: Characterization of Their Interesting Optical Properties and the Mechanism of Their Photochemical Formation. thesis for the DegreeDoctor. Georgia Institute of Technology.
Thakur M.S, Shwetha N, Selvakumar L.S. 2013. Aptamer–nanoparticle-based chem luminescence for p53 p Anal. Biochem, 262(2):137-56.
Yguerabide J, Yguerabide E 1998. Light-scattering submicroscopic particles as highly fluorescent analogs and their use as tracer labels in clinical and biological applications. Anal. Biochem, 262(2):137-56.
Zhou L, Wang MH, Wang JP, Ye ZZ. 2011. Application of Biosensor Surface Immobilization Methods for Aptamer. Chinese Journal of Analytical Chemistry. 39(3):432-8.
CAPTCHA Image