Food Technology
Mohammad Hadian; Mostafa Mazaheri Tehrani; Mohsen Ghods rohani
Abstract
IntroductionDoogh is a fermented dairy product that is produced by blending yogurt with water and some salt. This fermented beverage is widely consumed as a refreshing drink in Iran and other Middle East countries. Doogh is a source of calcium needed by the body on a daily basis and contains B vitamins ...
Read More
IntroductionDoogh is a fermented dairy product that is produced by blending yogurt with water and some salt. This fermented beverage is widely consumed as a refreshing drink in Iran and other Middle East countries. Doogh is a source of calcium needed by the body on a daily basis and contains B vitamins that are effective in the health and strength of teeth and bones. In addition, doogh contains a low percentage of fat, which makes it a diet drink. Whey Protein Concentrate (WPC) is a product contains 25 to 89% protein and different amounts of lactose, fat and minerals. Due to the functional properties of whey protein and its nutritional value; whey protein is widely used in dairy products. The development of cross-linking bonds between protein chains by enzymes is very important today. Enzyme cross-linking of proteins can affect some of their functional properties such as solubility, water absorption, rheological and emulsifying properties. One of the most widely used enzymes in the food industry is the transglutaminase enzyme. In this study the effects of WPC in three levels (0%,1% and 2%) and the transglutaminase enzyme in two levels (0 and 1 unit per gram of milk protein) in two method of dough preparation (adding water to yogurt and fermented milk diluted with water) on rheological characteristics, and microstructure of doogh were studied. Material and MethodsRaw milk was provided by Pegah Khorasan Company, WPC from Multi Company) Mashhad (and Trans glutaminease enzyme from BDF Company of Spain. WPC was first added to milk at 45 ̊ C at three levels of zero, 1 and 2%.The milk samples were then pasteurized at 85 ̊ C for 30 min. After lowering the temperature to 45 ̊ C, the enzymatic operation was performed at two levels of zero and one unit (per gram of protein).To complete the enzyme function, the samples were incubated for 180 minutes at 45 ̊ C. Then a temperature of 90 ̊ C was applied for 1 minute to inactivate the enzyme. The samples were then cooled to 45 ̊ C. At this stage, the samples were divided into two parts. In one part of the samples; milk was diluted with water in a ratio of 6% of the total dry matter for direct production of doogh. After adding the starter, the samples were transferred to an incubator and hold at 43-42 ̊ C, until the pH reaches about 4.1.Thefermented samples were then transferred to a refrigerator. In the second part, starter was added to milk to produce yogurt; after adding starter, the mix was transferred to an incubator and hold at 43-42 ̊ C, until the pH reaches about 4.1. Doogh was produced by diluting yogurt with waterto givethe final product with 6% of total dry matter. Results and Discussion In both production methods, in samples treated only with WPC, the average particle size increased with increasing WPClevel. In both methods, the production of only enzymatically treated samples led to the formation of smaller particles with a more uniform shape and distribution. In samples of doogh produced by both production methods, WPC and transglutaminase enzyme changed the flow characteristics of doogh to non-Newtonian behavior. Samples made directly from milk had significantly higher viscosity than samples made from yogurt. In samples without enzymatic treatment, the microstructure was smooth and homogeneous with smaller particles than other samples. These particles settle very quickly. In the samples where WPC treatment was applied, the amount of large particles and non-uniformity increase with increasing WPC level. The distribution of particles in samples made directly from milk was more regular than samples made from yogurt.
Nafiseh Karimi; Rezvan Pourahmad; Salman Taheri; Orang Eyvazzadeh
Abstract
Introduction: Yogurt contains valuable compounds, some of which enter yogurt whey and if discarded, remains unused. Yogurt whey has a high nutritional value due to its high quality biological proteins which can be a good source of bioactive peptides. Bioactive peptides are food-derived peptides that ...
Read More
Introduction: Yogurt contains valuable compounds, some of which enter yogurt whey and if discarded, remains unused. Yogurt whey has a high nutritional value due to its high quality biological proteins which can be a good source of bioactive peptides. Bioactive peptides are food-derived peptides that are small in size and usually consist of 3- 20 amino acids. These peptides are considered as functional ingredients. Bioactive
peptides have antioxidants and antimicrobial properties. The aim of this study was to investigate the effect of adding bioactive peptide derived from enzymatic hydrolysis of yogurt whey on physicochemical, sensory and microbial properties of doogh during storage.
Materials and Methods: In this study, peptide derived from tryptic hydrolysis of yogurt whey protein fractionated by RP- HPLC was used. Minimum inhibitory concentration (MIC) and Minimum bactericidal concentration (MBC) of this peptide were determined against Staphylococcus aureus and Escherichia coli. This peptide was incorporated to heated doogh at concentrations of 12, 20, 24, 40, 48, and 80 mg/mL. Moreover, doogh samples were inoculated with 106 CFU/mL Staphylococcus aureus and Escherichia coli. Doogh samples were stored for two months. During 60 days storage, bacterial count, pH, acidity, ABTS radical cation inhibitory activity and sensory properties (taste, odor, texture, color and overall acceptance) of doogh samples were studied.
Results and Discussion: The MIC of yogurt whey peptide against Staphylococcus aureus and Escherichia coli was 12.2 and 24.4 mg/mL, respectively. Moreover, the MBC of yogurt whey peptide against Staphylococcus aureus and Escherichia coli was 12.2 and 48.8 mg/mL, respectively. Addition of this peptide to doogh showed that during storage period, the Staphylococcus aureus and Escherichia coli counts, pH and ABTS cation radical inhibitory activity of the samples were significantly decreased, but acidity was increased (p<0.05). The peptide of yogurt whey showed good antioxidant and antibacterial activities in doogh samples. By increasing the level of peptide in samples, the ABTS cation radical inhibitory activity was significantly increased (p<0.05). During storage, the control sample (without bioactive peptide) showed the highest reduction in antioxidant activity and the lowest reduction was related to the sample containing 48.8 mg/mL bioactive peptide. The ABTS cation radical inhibitory activity of the control sample and sample containing 48.8 mg/mL bioactive peptide was 9.72 and 3.66 Unit/mL, respectively on the 60th day. By increasing the levels of bioactive peptide, pathogenic bacteria counts were decreased (p<0.05). The sample containing the highest level of peptide (48.8 mg/mL) was free of Staphylococcus aureus and E. coli on the 20th day of storage. The control sample and samples containing 12.2 and 24.4 mg/mL bioactive peptide were free of these pathogenic bacteria on the 60th and 40th days, respectively. The highest rate of acidity and pH changes was related to the control sample and sample containing 48.8 mg/mL bioactive peptide had the lowest changes during storage. The acidity of control sample and sample containing 48.8 mg/mL bioactive peptide was 0.68 and 0.56% lactic acid, respectively on the 60th day.The results of sensory evaluation showed that in the control sample and sample containing the lowest level of peptide (12.2 mg/mL), the score of sensory characteristics decreased during the storage period, however, the use of the highest level of yogurt whey peptide (48.8 mg/mL) in the doogh formulation was able to reduce the rate of loss of sensory properties and maintain product quality over time. The sample containing 48.8 mg/mL bioactive peptide had the highest score of overall acceptability. Finally, the concentration of 48.8 ppm peptide can be considered as the best level to enrich the doogh in terms of physicochemical, microbial and sensory properties. Therefore, it is concluded that bioactive peptide derived from yogurt whey can be used as a natural antioxidant and antimicrobial agent in fermented dairy products like doogh.
Hajar Shahsavar; Marzieh Bolandi; Homa Baghaei
Abstract
Introduction: Plant extracts have antimicrobial properties and can be substituted as chemical flavorings in food. Preservatives are compounds that are used to inhibit the growth or to eliminate harmful microorganisms to increase the shelf life of foods. Nowadays, the use of natural preservatives derived ...
Read More
Introduction: Plant extracts have antimicrobial properties and can be substituted as chemical flavorings in food. Preservatives are compounds that are used to inhibit the growth or to eliminate harmful microorganisms to increase the shelf life of foods. Nowadays, the use of natural preservatives derived from medicinal plants is increasing due to their greater compatibility and the presence of volatile compounds (Celiktas et al., 2007). The antimicrobial properties, antioxidant and anticancer effects of these natural additives have been proven (Tajkarimi et al., 2010). In this study, the antimicrobial activity enhancement effect of the combination of hydroalcoholic extracts of basil, cinnamon and salvia on Escherichia coli, Staphylococcus aureus and Saccharomyces cerevisiae yeast in Iranian yoghurt drink (doogh) was investigated for 4 weeks at ambient temperature. Materials and Methods: The milk was boiled in hygienic conditions at 95 ° C for 5 min. After cooling to 45 ° C, they were inoculated. The aerial parts of the studied plants were milled and powdered. Cinnamon, basil and salvia extracts were then soaked. The food strains of Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 700728 and Saccharomyces cerevisiae PTCC 5193 were prepared as lyophilized ampoules. The microdilution broth method was used to determine the minimum inhibitory concentration. The minimum bactericidal concentration (MBC) was determined in accordance with the minimum inhibitory concentration (MIC) results. To determine the antimicrobial effect of the extracts on the yoghurt drink, 9 ml of the prepared yoghurt drink was poured into each test tube. Then 1 cc of each extract and 1 cc of microbial suspension (1.5 × 108 CFU / ml) were added. One tube was considered as positive control (bacteria + yoghurt drink), one negative control tube (extract + yoghurt drink) and one control tube (yoghurt drink only) and the tubes were placed at ambient temperature. Then, on day 7, 14, 21 and 30 during storage, 20 µl of each tube, were cultured on Muller Hinton agar medium and the same amount of yeast was cultured on blood agar medium. After incubation for 24 h at 37 ° C, the colonies were counted. The interaction of antimicrobial activity of the combination of basil, cinnamon and sage extracts was evaluated on the basis of differential inhibitory concentration index (FIC). Results and discussion: The results showed that the minimum inhibitory concentration of the combined basil, cinnamon and sage extracts against Staphylococcus aureus and Saccharomyces cerevisiae and Escherichia coli were 0.4, 0.4 and 3.12 mg / ml, respectively. Also, Staphylococcus aureus was more susceptible to the extracts, which were used alone, and was inhibited by a lower concentration of used extract (Ahmadi et al., 2018). However, due to the maximum minimum inhibitory concentration (MIC), Escherichia coli was less sensitive to the extracts which was used alone. The combined usage of all three extracts significantly reduced the maximum minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC), indicating that their antimicrobial activity was more effective against the studied microorganisms than each of the extracts which was used alone. The results of this study showed that synergistic effect against Staphylococcus aureus and Saccharomyces cerevisiae was more effective with the combination of the aforementioned extracts (p <0.05). The results of the Escherichia coli population counting during storage indicated that most of the extracts had a good effect on preventing the growth of Escherichia coli in the doogh environment compared to the control sample (p <0.05). Addition of the extract significantly prevented pH reduction over time (p <0.05), so that the control sample had the highest and the sample containing all three extracts showed the lowest pH changes over time (p <0.05). Therefore, it can be concluded that acid production by Lactobacillus bacteria in samples containing extract during storage period was higher than control. The results of this study were in agreement with the results of Mortazavian et al., (2007) and Voosogh et al., (2009). The acidity of the doogh samples increased significantly over time (P<0.05), while the addition of the extract significantly prevented the acidity increase over time (P<0.05). Sensory properties are the main factors of acceptance and satisfaction of many products. In this study, the mean viewpoint of doogh samples containing the combination of the three above mentioned extracts in terms of taste, odor, color and general acceptance are acceptable. Additionally, it was found that about 90% of participants were willing to use it. Although studies of the overlapping or synergistic effects of medicinal plant extracts in real food environments are not extensive, their results have shown that, the addition of different medicinal plants compounds can increase antibacterial effects. Therefore, the simultaneous use of these extracts can be used in effective control of food pathogens as a complementary method. The results of this study were in agreement with the results of Karimi (2007).
Reza Mobasserfar; Seyed Ali Mortazavi
Abstract
Introduction: Doogh is one of the most important and most widely consuming fermented traditional Iranian milk products, which is being prepared from the healthy milk by using the activity of certain lactic acid bacteria and molds under the especial conditions. Streptococcus thermophilus and Lactobacillus ...
Read More
Introduction: Doogh is one of the most important and most widely consuming fermented traditional Iranian milk products, which is being prepared from the healthy milk by using the activity of certain lactic acid bacteria and molds under the especial conditions. Streptococcus thermophilus and Lactobacillus bulgaricus are used as starter culture for milk fermentation. The fermented dairy products have long storage life and constitute an important part of the milk's per capita consumption. For this reason, studying the different methods in order to improve the quality of these products is crucial. By considering the fact that the strong thermal treatments damage some components of milk such as protein and vitamins, using the membrane filterations decrease the need to impose the intense thermal conditions which result into the relative loss of nutrients. On the other hand, using the membrane filters not only increase SNF (solid non-fat) and the percentage of protein but also lead into the production of less-lactose milk as well, the production of less-lactose products, in addition to their nutritional value for some people, have especial benefits for improving the quality. As follows, UF filters in 10-2-10-1 diameter separate the bacteria, fats and protein when milk is passing with a pressure about 1-10 bar but also they pass the minerals such as salts and water which are being removed as permeate and the concentrated milk is called “Retentate”. Materials and methods: Materials provided in this study were including: Starter culture (No: 505 form Danisco, USA), Lactic acid (1.00366) with a degree of purity level more than 95%, NaH2PO4*2H2O (1.06345) plus the cultures' environment and the chemical substances from MERCK Company. HPLC system (Agilent, 1100 series, USA), Rheometer (Anton, MCR300, Austria), Milk analyzer bar (Azmalaban, MCC, Iran), pH meter (Knick,766, Germany), Digital scale 0.001 (AND,GF4000, Japan), Psychrometer (Sartorius, MA45, Germany), Oven (memmert, UM400, Germany), Centrifuge (Funke Gerber, Nova safety, Germany), Kjeldahl (Gerhardt, KB, Germany), Refrigerated incubator (WTW,TS606-6/2-i, Austria), Incubator (memmert, BM400, Germany), Autoclave (RT-2, Reyhan Teb, Iran). In the present study the effect of a decrease in lactose percentage on the durability, flavor and sensory (organoleptic) properties of produced doogh on the 1st, 23rd and 46th day’s after production time in comparison to control ones, was investigated. The changes of acetaldehyde levels were measured using Gas chromatography mass spectroscopy. In this study, milk was passed through UF filters in three consecutive days and its lactose level was decreased by about 2%. After that fermentation and standardization of doogh based on the amount of fat and solid-nonfat has been done. All tests were repeated 3 times and the comparison of averages has been done by using LSD test (p= 0.05 %). Results were expressed as mean ± SE. Values were the average of triplicate experiments. Significant differences between the results were calculated by analysis of variance (ANOVA) with the help of SPSS software version 20. Differences at P<0.05 were considered to be significant. Also the obtained data for the rheological experiments was processed using software such as Excel 2010 and SPSS software version 20 to determine an appropriate mathematical model. And in this case, the linear and nonlinear regressions were used. Results & discussion: Results showed that by increasing the storage time, the acidity and pH changes and the acetaldehyde amount of produced doogh was less than those of the control samples. Additionally flavor and sensory properties improved considerably. Based on the findings of this research, it seems that the reduction of lactose and the decrease of lactic acid bacterial activity can play an important role in increasing the durability time, improving the sensory properties and enhancing the quality of doogh. It was determined that the decrease of lactose using ultrafiltration to the control sample not only indicates the significant changes in most considered variables but also there are these kinds of changes during the durability time. In addition, the significant and slow changes of pH to the control sample due to the decrease of lactic bacteria activities show the least qualitative and flavor changes over the durability time. And also it was specified that by increasing the activities of lactic bacteria, the amount of acetaldehyde will increase but by decreasing this activity, the level of acetaldehyde will decline. This issue has a direct relationship with the changes of lactose's amount. The post-filtration doogh due to its high amount of proteins shows high viscosity and concentration and for this reason, the attention of panelists in the sensory evaluation was directed toward choosing the post-filtration doogh instead of the pre-filtration one. Therefore, it can be concluded that the decrease of lactose using ultrafiltration has a main role in improving the quality of the product and also the tendency of the consumers.
Nafiseh Davati; Shohreh Hesami
Abstract
Introduction: Nowadays, More people are interested in consuming organic products. Many of the organic foods and dairy products are produced by rural people and nomads in Iran. Some people are concerned about using of the contaminated organic foods with pathogenic microorganisms, because some of these ...
Read More
Introduction: Nowadays, More people are interested in consuming organic products. Many of the organic foods and dairy products are produced by rural people and nomads in Iran. Some people are concerned about using of the contaminated organic foods with pathogenic microorganisms, because some of these organic foods are produced under poor hygienic conditions. On the other hand, many native strains of probiotic bacteria especially lactic acid bacteria can be found in these organic foods. In this study, the microbial community and sanitary quality of ewe’s drinking yogurt produced by Somar region nomads, by using culture dependent molecular method and next-generation sequencing (NGS), as a new tool for the culture independent molecular characterization of bacteria, were assessed.
Materials and methods: A total of three Ewe's drinking yogurt samples were collected from the nomads of Somar region in Iran under sterile conditions. For phenotypic identification of lactic acid bacteria, a volume of 0.1 milliliters of appropriate dilutions was cultured on MRS agar and M17 agar media. The plates were incubated at 37oC under anaerobic condition with Anaerocult® A for 48 hours. Typical LAB characteristics colonies were purified by streaking method on MRS agar and M17 agar. The catalase negative and Gram positive isolates were selected as presumptive lactic acid bacteria for phenotypic identification to the genus level. These isolated bacteria were tested for growth at 100C and 450C in MRS and M17 broth, gas production from glucose, growth in the presence of 6.5% and 18% of NaCl, growth at pH 4.4 and pH 9.6 and arginine hydrolysis. Isolates were identified by amplification of the 16S ribosomal RNA gene by Polymerase Chain Reaction and ribosomal DNA sequencing as a culture dependent molecular method. After DNA extraction of isolates, PCR was performed using prokaryotic 16S rDNA universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3). In the next step, the culture-independent molecular method based on next-generation sequencing of 16S ribosomal RNA gene amplicons was applied. The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locus‐specific sequences were: Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐ [locus- specific sequence] Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed. The fastq files from the next generation sequencing were analyzed with BaseSpace (cloud‐based software, MSR: Metagenomics, version: 2.4.60.8). This metagenomics analysis classified organisms from V3 and V4 amplicon using a database of 16S rRNA data and performed a taxonomic classification using the Greengenes database showing species level classification in a graphical format (http://greengenes.lbl.gov/). The analysis output was a classification of reads at several taxonomic levels: kingdom, phylum, class, order, family, genus, and species. The analysis results included tables, cluster pie charts, phylogenetic trees and bar charts. The average and error bars of the relative abundance (%) of bacterial species from ewe’s milk and yogurt were calculated using Microsoft Excel 2010 software.
Results & Discussion: A total of 40 bacteria as lactic acid bacteria were isolated from ewe’s drinking yogurt. Among isolated bacteria, two different genus of lactic acid bacteria were phenotypically characterized as 88% Lactobacillus, 3.5% Pediococcus and 8.5% Non-lactic acid bacteria. Isolates were identified by ribosomal DNA sequencing as Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus.
The microbial community from ewe’s drinking yogurt were identified on the basis of Next-generation sequencing (NGS) at genus level as 94.08% Lactobacillus, 1.07% Pediococcus, 0.33% Streptococcus, 0.20% Enterococcus, 0.11% Candidatus Blochmannia, 0.11% Alkalibacillus, 0.06% Cohnella and 3.02% unclassified. At species level 24.82% Lactobacillus equicursoris, 51.81% Lactobacillus delbrueckii, 3.61% Lactobacillus apis, 2.79% Lactobacillus ultunensis, 0.86% Lactobacillus taiwanensis, 0.85% Lactobacillus gigeriorum, 0.42% Pediococcus argentinicus and 13.64% unclassified were identified. Findings of this study have provided fundamental knowledge on sanitary quality and microbial composition of drinking yogurt produced by Somar nomads. Both phenotypic and molecular identification methods showed Pediococcus and Lactobacillus genus as the dominant genera in these samples. Molecular identification results showed Lactobacillus delbrueckii as the dominant species. Four species, Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus were identified by both cultivation-dependent and cultivation-independent (NGS) methods. Rather, culture-dependent and culture-independent methods were found to be complementary in describing the microbial community of the ewe’s drinking yogurt produced by Somar nomads. The next-generation sequencing was found to be more accurate method in detecting the microbial diversity of drinking yogurt. The results showed poor hygienic quality of ewe’s drinking yogurt from Somar nomads, but there were no pathogenic bacteria in this product.
Ahmad Ehtiati; Fakhri Shahidi; Mohebbat Mohebbi; Masoud Yavarmanesh
Abstract
SMP was substituted by WPC in four levels for preparing reconstituted milk. Two ropy and one nonropy starter cultures was used for Doogh preparation. Yield stress, viscosity, consistency index and pseudoplastic behavior of Doogh increased by increasing WPC content. Results showed that WPC increased colloidal ...
Read More
SMP was substituted by WPC in four levels for preparing reconstituted milk. Two ropy and one nonropy starter cultures was used for Doogh preparation. Yield stress, viscosity, consistency index and pseudoplastic behavior of Doogh increased by increasing WPC content. Results showed that WPC increased colloidal particles dimension and constructed a network which led to a decrease in Doogh phase separation (%32 at the highest level of WPC) during storage. Starter type had no effect on the Doogh stabilization. It does not have any effect on the studied physical properties in the presence of WPC, as well. Adding WPC to milk leads to improve of physical properties and stability of Doogh but using EPS producing starter cultures requires further studies in this field.
