Arezoo Hashemnia; Vahid Hakimzadeh
Abstract
Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields ...
Read More
Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields which, when they interact with electromagnetic resonance radiation, their radiant properties rises sharply. This process causes the absorption process of these nanoparticles to be several times stronger than the absorption process of the strongest adsorbent molecules and their scattered light is several times more intense than the organic materials fluorescence. These unique properties provide a high potential for these nanoparticles to be used in many applications such as biochemical sensors, biomedical imaging and medical treatments. Aptamers are single-stranded oligonucleotides, DNA, RNA or proprietary proteins that have the ability to attach specifically to their target. The basis for identifying the target by aptamers is the third structure formed by them. One of the important benefits of aptamers to antibodies is their smaller size, which makes them more easily and effectively penetrated. It also has neither toxicity nor immunogenicity unless in very low levels. Therefore, biosensors that use aptamers as biological identifiers are known as aptasensors. In this research, due to the high losses caused by aflatoxins to the crops and their toxicity, the rapid detection of these pesticides by aptasensor method was investigated. Materials and methods: The test was carried out in a 96-well plate and for each concentration three replicates were considered. In each test, 100 μl of the nano gold solution, which was centrifuged twice at 12000 rpm and at room temperature, was thrown into 11 concentrations and three repetitions in the plate houses. Then adding 15 μlit of aptamer at a concentration of 5 μmol plus 10 μlit of distilled ultrapure water to the houses and incubate for 30 minutes at room temperature. After this time, 25 μlit of different concentrations of aflatoxin plus 15 μlit of 2 molar salt solutions and 35 μlit of distilled water were added to the houses and, after mixing (up and down) in the ELISA reader, absorbed it we read. Results and discussions: At first, with adding the aptamer to Nano gold particles a complex between nanoparticles and aptamer is created. But in present of suitable aflatoxin, the complex of nanoparticle and aptamer is separated and a new complex between aflatoxin and nanoparticle is formed. Subsequently the color is changed to purple. This color change is visible to the eye, indicating that the Aptamer is suitable for Target. In this study, it was found that an aptamer with GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA sequence only affects aflatoxin G1 and other aflatoxins such as B1, B2, and G2 should be considered as another sequencer for Aptamer.
Nasim Pourebrahim; Masoud Yavarmanesh
Abstract
Introduction:Pistachio nut is one of the popular tree nuts. Among the different species of the genus Pistacia, only the fruits of Pistacia vera attain optimal size to be acceptable to consumers as edible nuts. Contamination of pistachio by Aspergillus species and their mycotoxins is the most important ...
Read More
Introduction:Pistachio nut is one of the popular tree nuts. Among the different species of the genus Pistacia, only the fruits of Pistacia vera attain optimal size to be acceptable to consumers as edible nuts. Contamination of pistachio by Aspergillus species and their mycotoxins is the most important problem for consumption and export of this product. Aflatoxins are potent toxic, carcinogenic and mutagenic secondary metabolites primarily produced by two fungal species, Aspergillus flavus and Aspergillus parasiticus. Aspergillus flavus produces AFB1 and AFB2, while Aspergillus parasiticus produces AFB1, AFB2, AFG1 and AFG2. Among four main groups of aflatoxins, AFB1 is the most potent carcinogenic compound. Therefore, identification of toxigenic fungi is necessary for evaluating the foods quality and the presence of mycotoxins. The current methods being used for assessing fungi presence in foods based on cultivation methods and microscopic characteristics are time-consuming and labor-intensive. Recently, molecular techniques such as polymerase chain reaction (PCR) due to high sensitivity, specificity and rapidity has been introduced as powerful tools for detecting toxigenic fungi. Many genes involved in the biosynthesis of these mycotoxins have been identified and their DNA sequences have been published. PCR methods can be used to detect of aflatoxigenic Aspergilli based on structural genes (nor1, ver1 and omtA) encoding key enzymes in aflatoxin biosynthesis pathway and the regulatory gene aflR.
Materials and method: Pistachio samples were collected from different cultivation regions of two towns including Gonabad and Feyzabad. Samples were packed in sterile plastic bags and immediately transferred to the laboratory. The moisture content of samples was determined using thermal method and drying in at 95-100°C. Among fungal isolates 30 Aspergillus genus were detected and purified by cultural-based methods using PDA (potato dextrose agar) medium. Colonies of the fungus were transferred to PDB (potato dextrose broth) medium and incubated for 5 days at 28°C with shaking at 150 rpm. The mycelium was frozen in liquid nitrogen and ground to a powder for later DNA isolation. DNA was extracted with CTAB (cetyl trimethyl ammonium bromide) extraction buffer, then was purified with organic solvents such as chloroform/isoamyl alcohol and finaly was precipitated by isopropanol. Aspergillus genus were detected using polymerase chain reaction by specific primer pair Asp1/Asp2 for amplification of 18S rRNA region. Furthermore, aflatoxigenic genes were detected by three sets of primers (APA-450/APA-1482, ver1/ver2 and OMT-208/OMT-1232). PCR was performed in a volume of 25 µl containing 0.5 µl of each primer, 12.5 µl of Taq DNA polymerase master mix red, 10.5 µl of sterile distilled water and 1 µl of genomic DNA as template. A PCR consisted of an initial denaturing step of 5 min at 94°C followed by 35 cycles (30 s at 94°C, 35 s at 65°C and 40 s at 72°C) finished by a final extension step at 72°C for 10 min. The PCR products were analyzed by electrophoresis on a 1% agarose gel in TBE.
Results and Discussion: Among fungal isolates 30 Aspergillus genus were detected using microscopic characterstics and colony color. Under the microscope, conidia were one-celled, spherical, hyaline or pigmented and they formed long chains. 12 and 4 out of 30 samples had omtA and ver1 genes respectively. No observation was found for aflR regulatory gene in the fungal isolates. The results showed that although some isolates had one or two structural genes in the aflatoxin biosynthetic pathway, they could not produce aflatoxin due to not having any aflR gene. Coefficient of correlation was calculated to find the relationship between the existence of Aspergillus molds and aflatoxigenic genes in pistachio. The statistical results indicated that there is a significant correlation between the enumeration of Aspergillus molds and the existence of genes (omtA and ver1) in different moisture domains (p> 0.05) while no significant correlation was identified between the enumeration of Aspergillus molds and the existence of genes in different domains of enumeration of mesophilic bacteria, yeasts and molds. Contamination of nut seeds by fungi occurs during growth, harvesting, transport and storage. The production of aflatoxin is affected by different factors, such as genetic properties of the producing fungi, temperature, moisture content, the chemical composition of food and antimicrobial agents produced by other microorganisms. Water stress and temperature are the most relevant environmental factors which influence fungal growth and mycotoxin production. Other studies showed that there was a good correlation between the expression of an early structural gene (aflD) and aflatoxin B1 production in peanut seeds. Also previous studies have shown that there was a significant relationship between A.flavus contamination in the peanuts and pistachio with high humidity (p> 0.05). Since other factors such as temperature, pH and chemical composition of pistachio can affect the existence of Aspergillus molds and expression of aflatoxigenic genes, the influence of these factors on existence of Aspergillus molds and genes involved in aflatoxin biosynthesis pathway need to be investigated.
