with the collaboration of Iranian Food Science and Technology Association (IFSTA)
Volume & Issue: Volume 14, Issue 5 - Serial Number 53, November and December 2018 
Research Article

Comparison of microbial diversity of ewe's drinking yogurt from somar region nomads using Next-Generation Sequencing and culture dependent molecular methods

Pages 685-698

https://doi.org/10.22067/ifstrj.v14i5.69335

Nafiseh Davati, Shohreh Hesami

Abstract Introduction: Nowadays, More people are interested in consuming organic products. Many of the organic foods and dairy products are produced by rural people and nomads in Iran. Some people are concerned about using of the contaminated organic foods with pathogenic microorganisms, because some of these organic foods are produced under poor hygienic conditions. On the other hand, many native strains of probiotic bacteria especially lactic acid bacteria can be found in these organic foods. In this study, the microbial community and sanitary quality of ewe’s drinking yogurt produced by Somar region nomads, by using culture dependent molecular method and next-generation sequencing (NGS), as a new tool for the culture independent molecular characterization of bacteria, were assessed. Materials and methods: A total of three Ewe's drinking yogurt samples were collected from the nomads of Somar region in Iran under sterile conditions. For phenotypic identification of lactic acid bacteria, a volume of 0.1 milliliters of appropriate dilutions was cultured on MRS agar and M17 agar media. The plates were incubated at 37oC under anaerobic condition with Anaerocult® A for 48 hours. Typical LAB characteristics colonies were purified by streaking method on MRS agar and M17 agar. The catalase negative and Gram positive isolates were selected as presumptive lactic acid bacteria for phenotypic identification to the genus level. These isolated bacteria were tested for growth at 100C and 450C in MRS and M17 broth, gas production from glucose, growth in the presence of 6.5% and 18% of NaCl, growth at pH 4.4 and pH 9.6 and arginine hydrolysis. Isolates were identified by amplification of the 16S ribosomal RNA gene by Polymerase Chain Reaction and ribosomal DNA sequencing as a culture dependent molecular method. After DNA extraction of isolates, PCR was performed using prokaryotic 16S rDNA universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3). In the next step, the culture-independent molecular method based on next-generation sequencing of 16S ribosomal RNA gene amplicons was applied. The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locus‐specific sequences were: Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐ [locus- specific sequence] Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed. The fastq files from the next generation sequencing were analyzed with BaseSpace (cloud‐based software, MSR: Metagenomics, version: 2.4.60.8). This metagenomics analysis classified organisms from V3 and V4 amplicon using a database of 16S rRNA data and performed a taxonomic classification using the Greengenes database showing species level classification in a graphical format (http://greengenes.lbl.gov/). The analysis output was a classification of reads at several taxonomic levels: kingdom, phylum, class, order, family, genus, and species. The analysis results included tables, cluster pie charts, phylogenetic trees and bar charts. The average and error bars of the relative abundance (%) of bacterial species from ewe’s milk and yogurt were calculated using Microsoft Excel 2010 software. Results & Discussion: A total of 40 bacteria as lactic acid bacteria were isolated from ewe’s drinking yogurt. Among isolated bacteria, two different genus of lactic acid bacteria were phenotypically characterized as 88% Lactobacillus, 3.5% Pediococcus and 8.5% Non-lactic acid bacteria. Isolates were identified by ribosomal DNA sequencing as Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus. The microbial community from ewe’s drinking yogurt were identified on the basis of Next-generation sequencing (NGS) at genus level as 94.08% Lactobacillus, 1.07% Pediococcus, 0.33% Streptococcus, 0.20% Enterococcus, 0.11% Candidatus Blochmannia, 0.11% Alkalibacillus, 0.06% Cohnella and 3.02% unclassified. At species level 24.82% Lactobacillus equicursoris, 51.81% Lactobacillus delbrueckii, 3.61% Lactobacillus apis, 2.79% Lactobacillus ultunensis, 0.86% Lactobacillus taiwanensis, 0.85% Lactobacillus gigeriorum, 0.42% Pediococcus argentinicus and 13.64% unclassified were identified. Findings of this study have provided fundamental knowledge on sanitary quality and microbial composition of drinking yogurt produced by Somar nomads. Both phenotypic and molecular identification methods showed Pediococcus and Lactobacillus genus as the dominant genera in these samples. Molecular identification results showed Lactobacillus delbrueckii as the dominant species. Four species, Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus were identified by both cultivation-dependent and cultivation-independent (NGS) methods. Rather, culture-dependent and culture-independent methods were found to be complementary in describing the microbial community of the ewe’s drinking yogurt produced by Somar nomads. The next-generation sequencing was found to be more accurate method in detecting the microbial diversity of drinking yogurt. The results showed poor hygienic quality of ewe’s drinking yogurt from Somar nomads, but there were no pathogenic bacteria in this product.

Research Article

The effect of packaging method on the physical, chemical, and organoleptic characteristics of walnut kernel during its storage

Pages 699-713

https://doi.org/10.22067/ifstrj.v14i5.68814

Somayeh Rastegar, Azam Shojaee, Behjat Tajeddin

Abstract Introduction: Persian walnut (Juglans regia) from Juglandaceae family is one of the most important fruits in the world that has an important role in human health. It contains a notable list of plant nutrients that has been found to have disease preventing and health promoting properties. Walnut is a source of bioactive compounds such as phenolic and flavonoid complexes where they act as antioxidants and free radical scavengers. It also contains pleasant flavor and high concentration of minerals and fatty acids. Extending shelf-life of this perishable fruit has been accomplished due to its high oil level and oxidation of oil (Tajeddin, 2004). Rate of loss in walnut kernel quality and quantity between harvest and consumption affects its productivity. Control of temperature is the most effective tool for extending the shelf life of fresh horticultural products. However, to reduce high losses and keeping product’s quality, packaging method is very important as well as low temperature. Therefore, in this study, the effect of temperature (4 and 25 oC) and packaging methods (vacuum and air packaging) on the changes of walnut kernel compounds was evaluated to improve quality of its storability during six month cold storage. Materials and methods: Walnut harvested from a commercial garden at the mountain regional of Raber, Kerman province. All chemical materials for different tests obtained from Merck Company, Germany. Immediately after walnuts harvesting, they were dehulled and dried in expose of sun shade with the circulation of natural air. The walnuts were then transferred to the laboratory and their wooden shells were removed. Subsequently, about 25 g of walnut kernel was packaged in the polyethylene films with 87μm (0.087 mm) thickness, under a vacuum machine and stored at 4°C and 25°C to be later assessed for further analyses intended for six months. Phenol, flavonoid, carbohydrate, protein, water percent, color parameters (C, h, WI), organoleptic characteristics, and peroxide value of kernels were measured every month during storage time. The control samples of packaged walnuts under environmental conditions were also stored. The current study carried out as a factorial assay on the basis of a completely randomized design with three replications at Hormozgan University. Data were subjected to ANOVA using SAS software version 9.4. Verification of significant differences was done using Duncan's Test at 1% probability level. Results and discussion: Results showed that carbohydrate and proteins decreased during storage time. Both of vacuum package and low temperature contorted the reduction of different characteristics of kernel such as bioactive compounds during storage significantly. Sensory properties were also reduced during storage, especially at the end of period, in all conditions except for treatment at 4°C and vacuum packing. Control samples (temperature 25°C and air-containing packags) during the experiment showed a lower quality for all factors. Samples that stored in low temperature and vacuum package had better brightness (higher chroma, Hugh, lightness (L) and white index values (Wi)) than other treatments. The treatments had a significant role in the preventing of increasing peroxide value. The peroxide value in treated samples was increased from 0.023 to 0.68 meq/g, while in vacuum packages it was changed from 0.023 to 0.37 meq/g. Increasing of peroxide value was observed from 0.023 to 0.68 and from 0.023 to 0.25 meq/g in room temperature and cold temperature, respectively. After six months, the average peroxide value in all samples was less than one milliequivalent per oil kilogram. Decreasing of phenolic compounds (30%) and flavonoids (35%) and increasing the peroxide index simultaneously led to the reduction of the appearance and organoleptic properties of the control samples. Generally, vacuum package and low temperature condition that using in this study showed the best effect on the nutritional compounds quality of walnut kernel such as bioactive components during six months storage. Shelf life enhancement of walnut by vacuum packaging in the different polymers has been already reported by Tajeddin, 2004.

Research Article

Determining the qualitative, textural and sensory characteristics of oil cakes made with flaxseed and oat bran as a fat replacement

Pages 715-724

https://doi.org/10.22067/ifstrj.v1395i0.39546

Sara Jamehdor, Sara Movahhed, Babak Ghiassi Tarzi

Abstract Introduction: The cake is considered as the bakery products and has the different kinds with different calorie and often high calories in the kinds of cakes is due to the oil, eggs and sugar that is used in its formulation .In the present study the carbohydrate-based fat replacements are used instead of fats for consuming. The flaxseed with the scientific name of "Linum usitalissmum" is an annual plant from the family of flax and in terms of nutritional value it is a good source of omega-3 (alpha-linolenic acid, ALA), Lignans (such as phyto-estrogenic), fiber, protein, minerals and vitamins. The high amount of water absorption by flaxseed in bakery products leads to increase the volume and improve the quality of bread and also increase the shelf life of the product produced. The oat is a plant from the family of grains and from the genus of "Avena" called in English "Oat". One of the major compounds in the oat is β-glucan. The said compound is the common name of glucose polymers that is found in the endosperm cell walls of barley and oat and usually forms 3-7% of the seed weight and is classified as soluble dietary fiber and carbohydrate-based fat replacements. The purpose of this study was to add different levels of flaxseed and oat bran as a part of fat replacement in cake. Different Levels of shortening were replaced with Oat bran and flaxseed powder and their effects on the chemical characteristics, volume, color, staling and sensory characteristics of the cakes were examined. Materials and methods: Raw materials needed to bake a cake included the null wheat flour (Mehbod Company) with extraction rate of 70%, sugar (Pardis Company), nonfat dry milk (IDI France Company), egg white powder (Talavang Company), table salt (Golha company), baking Powder (Golhan Company), oil (Ladan Company), flaxseed and oat bran (Sarv Company). Chemical tests performed on wheat flour, oat bran and flaxseed meal and samples of cakes included the measurement of moisture, ash, protein, fat, fiber, peroxide and pH were performed. For the production of cake the raw materials were prepared and were weighed. Then, the oil and sugar mixed for 2 minutes and then some water was added and mixed for 2 other minutes. Then, the null wheat flour, oat bran and flaxseed powder sieved with other materials were mixed. Finally, the cake was added to the mold and located in the tunnel oven at 170°C for 35 minutes for baking. in all the tests the control treatment (cake containing 100% fat and null wheat flour) with the code of C, the treatment containing the oat bran and flaxseed with the ratio of 20:40 (weight– weight of fat consumed) plus 40% of fat with the code of A1, the treatment containing the oat bran and flaxseed with the ratio of 40:20 (weight – weight of fat consumed) plus 40% of fat with the code of A2, the treatment containing the oat bran and flaxseed with the ratio of 30:30 (weight– weight of fat consumed) plus 40% of fat were determined with the codes of A3 revealed. The method proposed by Henry Simon British Company and device of volumeter were used to determine the volume of cake samples produced. The test of determining the color the Hunter Lab device was used. In order to determine the amount of staling of the cake samples, the device of evaluating the texture or Instron was used. In this study, examined by 10 trained evaluators was used for organoleptic test of samples. In determining the amount of staling in the cake samples produced the sensory method was used. This test was conducted at the intervals of 3, 7 and 10 days after baking of the samples. In order to investigate the quantitative characteristics of data considering to the presence of four treatments and three replications, randomized block design, the analysis of variance and the software "SPSS", version 16, were used. Results & discussion: The amount of protein and fiber in treatment of A1 and in the control treatment was the highest and the lowest, respectively. In addition, the amount of ash and moisture in the treatment of A2 and in the control treatment was the highest and the lowest, respectively. The treatment of A1 and the control samples had the highest and the lowest amount of peroxide, respectively. Results of specific volume test indicated that the treatment of A2 and the control samples had the highest and the lowest amount of specific volume, respectively. The results of colorimetric test of cake samples indicated that the lightness (L*) in the control cake and in the treatment of A1 was the lowest and the highest amount, respectively. Moreover, the amount of redness in treatment of A1 and control treatment was the highest and the lowest, respectively. The amount of yellowness in the control treatments and treatment of A2 was the highest and the lowest, respectively. The results of evaluating the sensory characteristics of cake samples produced by panelists showed that most sensory characteristics of the cake samples containing flaxseed and oat bran compared with the control had higher rating. The results of staling test in the cake samples produced by sensory method showed that the control treatment had the highest amount of staling and the treatments of A1, A2 and A3 had the lowest amount of staling, respectively. The results of staling test using device method showed that the control treatment had the highest amount of staling and the treatments of A1 and A2 had the lowest amount of staling, respectively. Finally, the treatment of A2 was introduced as the best treatment. In the present study, oat bran and flaxseed seed were used as a part of carbohydrate-based fat replacements in the cake to produce a healthier products with less fat and better nutritional compounds while improving the qualitative characteristics.

Research Article

Prediction of effective moisture diffusity and specific energy consumption of eggplant in continuous band drying using some novel methods

Pages 725-741

https://doi.org/10.22067/ifstrj.v14i5.66106

Mohammad Kaveh, Reza Amiri Chayjan, Yousef Abbaspour-Gilandeh, Tarahom Mesri Gundoshmian

Abstract Introduction: Eggplant (Solanum melongenaL.) is being cultivated in North America, Asia and the Mediterranean area. Its limited shelf life is one of the important restrictions in the trade of eggplant as a fresh product. Drying is one of the most current methods used to maintenance agricultural products. This process improves the food stability, since it reduces significantly the water and microbiological activity of the material and minimizes physical and chemical changes during its storage. Dynamic modeling of drying characteristics for various agricultural products, including artificial intelligence techniques that include artificial neural networks (ANNs), particle swarm optimization (PSO) and grey wolf optimizer (GWO) Which has attracted a lot of attention recently, because the ability to learn from these systems to detect fruit and vegetable behaviors is a complex process in which mathematical models simply do not apply in recent decades. The main objective of this research was to determine the effective moisture diffusivity, and specific energy consumption of eggplant slices with a semi-industrial continuous band dryer. Moreover, some novel methods including ANN, PSO and GWO as an approximating tools were developed and evaluated for prediction of Deff and SEC of the process. Materials and methods: Freshly harvested eggplant were purchased from a local market and stored in the refrigerator at about 4°C for experiments. The initial moisture content of eggplant was determined by oven method. About 40 g of eggplant slice (4 mm thickness) with three replicates were dried at 70°C for 24 h. Eggplant slice with average initial moisture content of 10.25% (d.b.) was chosen as the drying material. The dryer consists of an adjustable centrifugal blower, hot air suction tube, heater, control panel, air channel to uniform distribution of hot air, drying chamber, Belt (20 cm, 200 cm), three inverters (LS, Korea), temperature and humidity sensors, electrical motor, removable upper part, base, shafts, three infrared lamps (Philips, Belgium) and belt guide. The experiments were performed at air temperatures of 45, 60, and 75C, air velocities of 1, 1.5, and 2 m/s, and belt linear speeds of 2.5, 6.5, and 10.5 mm/s. Feed and cascade forward neural networks were used in this study. There are two types of multilayer perceptron neural network. Two training algorithms including LevenbergMarquardt (LM) and Bayesian regulation (BR) back propagation algorithms were used for updating network weights. The PSO is a simple, powerful and metaheuristic technique that can be applied to solve optimization problems. In the PSO model, every solution is showed as a particle that is alike to a bird flying via the space of a potential solution. In order to mathematically model the social governance of wolves when designing Grey Wolf Optimizer (GWO), assume the fittest solution as the alpha ( ). Consequently, the second and third best solutions are named beta ( ) and delta ( ), respectively. Results and discussion: In the present study, the application of Artificial Neural Network (ANN), particle swarm optimization (PSO) and grey wolf optimizer (GWO) for predicting the and was investigated. Based on several statistical operates [such as coefficient of correlation ( ) and mean-square error ( ), mean absolute error ( )], for predicting and was found that the GWO ( =0.9915, =0.9986, Respecively) performs better than the PSO (with =0.9927, =0.9890) and ANN (with = 0.9618, =0.9773) models. Drying behavior of eggplant slices at different air temperatures of 45, 60, and 75C, air velocities of 1, 1.5, and 2 m/s and belt linear speeds of 2.5, 6.5, and 10.5 mm/s was studied. The moisture ratio was reduced exponentially with drying time as expected. When the temperature was increased, the drying time eggplant fruit reduced. In other words, at high temperatures, the transfer of heat and mass was higher and the water loss was more excessive. Effective moisture diffusivity and specific energy consumption were calculated after drying of turnip fruit. Maximum values of for eggplant were 1.14×10-8 m2/s. The lowest amount specific energy consumption ( ) was calculated at the boundary of 130.62 MJ/kg.

Research Article

Antioxidant Activity of Gentisic and Alpha-resorcylic Acids in Bulk Oils and Emulsions

Pages 743-753

https://doi.org/10.22067/ifstrj.v14i5.66201

Azadeh Mardani Ghahfarokhi, Reza Farhoosh, Ali Sharif

Abstract Introduction: Hydroxybenzoic acids are a large family of phenolic acids capable of inhibiting one of the most destructive reactions called lipid oxidation. Their antioxidant activities are markedly influenced by the number and position of phenolic OH groups. Increasing the number of electron-donating groups in the molecule and their placement at the ortho and/or para positions of the phenolic ring, could lead to the increased ability of H atom abstraction or electron donating capacity. Gentisic (3,5-dihydroxybenzoic acid) and Alpha-resoecylic (2,5-dihydroxybenzoic acid) acids are dihydroxybenzoic acids wildly dispersed in the plant tissues with some valuable biological and pharmacological properties for human health. These compounds are different in structure and position of hydroxyl groups in phenolic ring, that may had a strong in‌fluence on their antioxidant properties. In addition of structural property, environmental interference can play an important role in the antioxidant potency. Antioxidants are found to behave differently when used in different media. Materials and methods: Partition coefficient (log P) of Gentisic acid and Alpha-resorcylic acid was measured between 1-octanol and acetate buffers. Antiradical and antioxidant activity of compounds was investigated in different medium (solvent system, purified bulk olive and soybean oils and their O/W emulsions). DPPH radical scavenging activity of gentisic acid and alpha-resorcylic acid was measured in the methanolic solvent. Progress of lipid oxidation in olive oil and soybean oil containing 200 ppm of the antioxidants at 80 oC was followed by monitoring the changes in peroxide value (PV). PV was measured spectrophotometrically at 500 nm using a UV– Vis instrument. Oxygen depletion in emulsion systems in the absence and present of the antioxidant (200 ppm) was measured using a YSI Model 5300A biological oxygen monitor at 37oC. The effectiveness of the antioxidants in bulk oils and emulsions was estimated on the basis of the induction period (IP). Results and discussion: The obtained results indicated that the effectiveness of the Gentisic and - resorcylic acids in free radicals scavenging, was greatly affected by molecular structure of these antioxidants and environmental conditions. Ortho position of hydroxyl group with respect to the carboxyl group in Gentisic acid, caused higher antiradical potency of Gentisic acid than α-resorcylic acid, with meta-structure, in different used mediums. In addition, it was found that the environment plays an important role in the free radical scavenging activity of phenolic compounds. Gentisic acid with more hydrophilic structure showed better antioxidant activity in bulk oil hydrophobic systems, than emulsion systems, while -resorcylic acid with less hydrophilic structure showed better activity in O/W emulsions. Both antioxidants showed low antioxidant performance in solvent system. The polar medium of the methanol used in DPPH assay, with enhanced intermolecular hydrogen bonds, decreased the radical scavenging potency of antioxidants.

Research Article

Evaluation of physicochemical properties of chicken nugget produced with amaranth seed flour

Pages 755-765

https://doi.org/10.22067/ifstrj.v14i5.66321

Maryam Tamsen, Nafiseh Soltanizadeh, Hajar Shekarchizadeh

Abstract Introduction: The main part of the further-processed foods especially fish, seafood, poultry, cheese and vegetables market is constituted of battered and breaded products. The annual consumption of battered and breaded products in some countries such as Europe, Japan, and Oceania is approximately 2 billion pounds. Frying of battered and breaded products is used to improve their quality factors which are mainly crispness, texture, moisture and oil contents, porosity, color and appearance, flavor and nutrition. Crispy outer layer and the moist and juicy interior as pleasant textural characteristics are created in fried foods. Chicken nugget which is made from chicken meat is breaded or battered, then deep-fried or baked and finally is quick frozen. Chicken nugget is composed of four layers including paste, pre-dust, batter and breaded layers. Amaranth is one of the pseudo-cereal grains which belongs to the Amaranthaceae family. The color of amaranth seed varies from milky white to yellow, golden, red, brown, and black. This plant has high nutritional and biological value. Amaranth seed contains starch (61/4%), protein (16/5%), unsaturated fats (5/7%), fiber (20/6%), vitamins (E, B2 and C), minerals (calcium, magnesium, zinc and iron) and phenolic compounds. The purpose of this study was to replace wheat flour with amaranth flour in order to reduce wheat grain dependence, improve the nutritional value of nuggets as well as explore the production possibility of a new product for celiac disease. Materials and methods: In order to investigate the effect of replacing of wheat flour by amaranth flour in nugget formulation, amaranth flour was used at 0, 50 and 100% levels separately in chicken paste, batter dough, and all layers of nugget (chicken paste, predust, and batter dough). Then, the chemical composition and pH of chicken nugget, chicken paste emulsion stability, cutting force, oil absorption, porosity, cooking loss, degree of oxidation, color and sensory characteristics of produced nuggets were evaluated. Results and discussion: Results showed that increasing the substitution percent would increase the nutritional value of nuggets. The pH of all produced nuggets containing amaranth flour was higher than the control sample and pH reduction occurred slower in them during 13 days of storage at 4 ° C. Emulsion stability was also affected by the replacement rate and reached the maximum content at full replacement. Samples with 100% incorporation of amaranth flour had the highest emulsion stability due to the presence of polar lipids and globulin in amaranth flour which are surface active agents. However, 50% substitution of wheat flour with amaranth flour in chicken paste significantly decreased emulsion stability as this sample had the lowest emulsion stability. It seems that the interaction of amaranth albumin proteins with wheat gluten proteins reduced soluble proteins, which caused emulsion stability reduction of chicken paste containing both amaranth flour and wheat flour. Also the presence of amaranth flour in nuggets significantly increased oil absorption, porosity, cutting force and cooking loss. Oil absorption of nuggets increased by increasing the amount of amaranth used in nugget production, as the control nuggets had the lowest oil absorption. Albumin proteins which are present in amaranth flour have high oil absorption capacity. Amaranth flour has low viscosity in gelatinization owing to the low amylose content of amaranth starch, which decreases the absorption of batter dough to the chicken paste and as a result cooking loss will increase. Porosity of nuggets increased by increasing the amount of amaranth flour in prepared nuggets. Globulin which constitutes about 20% of amaranth proteins is a good foaming agent. Entrapment of air bubbles by globulin caused porosity increase in nuggets. In addition, the results of moisture content of nuggets showed moisture removal of nuggets containing amaranth flour after frying. Steam pressure of evaporated water caused porous tissue in samples. Hardness, chewiness, gumminess, springiness, and cohesiveness of nuggets containing amaranth flour increased. The cutting force was increased significantly as a result of the amount of amaranth flour of nuggets as was expected. About the oxidation, increasing the substitution rate reduced the amount of malonaldehyde in the early days and reduced the oxidation process in 13 days of storage at 4 ° C. High amounts of phenolic compounds were found in amaranth flour, which could reduce lipid oxidation and spoilage of nugget. Amaranth flour darkened nuggets and by increasing amaranth content, that amount of L (brightness), a (redness) and b (yellowness) declined. Lightness of the outer layer of nuggets decreased by increasing the amaranth amount of nugget, due to the presence of bran and betacyanin pigment in amaranth flour which make it darker than white flour. Wheat flour could be substituted with amaranth flour in nugget production, increasing the nutritional value of product by increasing protein, fiber and minerals levels, with no undesirable effect on total acceptance of consumers.

Research Article

Mass transfer kenetics in infusion of phenolic compounds extracted from grape pomace into Aloe vera gel by osmotic dehydration

Pages 767-776

https://doi.org/10.22067/ifstrj.v14i5.67502

Elham Azarpazhooh, Parvin Sharayei, Farzad Gheibi

Abstract Introduction: The current study was carried out to investigate the kinetics of infusion of phenolic compounds extracted from grape pomace (Argol) into Aloe vera gel cylinders. Aloe vera gel was treated at 50 °C in different osmotic solution with (40, 50 and 60) % sucrose plus (10, 20 and 30) % Argol, for 0–120 min. The fruit to solution ratio was kept 1:4 (w/w) during all experiments. A two parameters model was used for prediction of kinetics of mass transfer and values of equilibrium moisture loss and solid gain. Moisture and solid effective diffusivities were estimated using Fick’s second law of diffusion. Results showed that Azuara model has the potential for estimating the equilibrium points. In addition, a good correlation between predicted and experimental values were obtained by this model. Besides, moisture and solid effective diffusivities increased by increasing sucrose solution and Argol from 40 to 50 percentage and 10 to 20 percentages, respectively. Moisture and solid diffusivities were found in the range of 0.61–4.23×10−9 m2/s and 2.13 –2.77 × 10−9 m2/s, respectively. Functional food is an emerging field in food science due to its increasing popularity with health-conscious consumers and the ability of marketers to create new interest in existing products. New by-product application should be investigated to have a positive environmental impact or to turn them into useful products. The use of by-product such as the grape juice pomace (Argol), results in the return of these valuable sources into the food cycle as well as an improvement in nutritional value and functional products in the food industry. Red grape (Vitis vinifera L.) pomace contains a large amount of polyphenolic compounds, therefore extraction of bioactive compounds promote human health. It is not as easy to mix the functional ingredient in the solid system as it is, in the case of the powder and liquid products. With the help of osmotic dehydration, many researchers have demonstrated the infusion of active compounds such as mineral, phenolic compounds, curcuminoids, probiotics and vitamins into solid food tissue. Fruits such as aloe vera, which have a short shelf life and are suitable system models for infusion of phenolic compounds during osmotic dehydration. Osmotic dehydration can prove useful in drying aloe vera (Aloe Barbadensis Miller) which contains several nutritional compounds, including polysaccharides, phenolics, antioxidants, vitamins, enzymes, minerals, and so forth. The phenomenon of osmotic dehydration can be modeled by the fundamentals of mass transfer that describe the origin of the diffusive forces that are involved in and control these processes. A two-parameter equation of Azuara was used to predict the kinetics of osmotic dehydration and the final equilibrium point. The internal mass transfer occurring during osmotic dehydration of food is usually represented by Fick’s second law which is the best known phenomenological model to represent the diffusional mechanism is the model of Crank, consisting of a set of solutions of Fick’s law of diffusion for different geometries, boundary conditions and initial conditions. To date, there is no research on mass transfer during osmotic dehydration of aloe vera. Therefore, the objective of the present work was the infusion of Argol phenolic compounds in alo vera gel through osmotic dehydration treatment to investigate mass transfer during osmotic treatment. Material and methods: The Aloe Vera was added to agar and shaped into cylindrical pieces (20×20 mm). Afterwards the pieces were floated in a solution of sugar (40, 50 and 60) percentage and Argol (10, 20 and 30) percentage. The weight ratio of osmotic medium to fruit sample was 4:1 to avoid significant dilution of the medium and subsequent decrease of the driving force during the process. The experiment was performed with constant temperature of 50 °C. Samples were removed from the solution at 30, 60, 90, 180, and 120 min of immersion, drained and the excess of solution at the surface was removed with absorbent paper. Afterward, the dehydrated samples from each group were drained and blotted with absorbent paper to remove excess solution. Each assay was made in triplicate. Weight and moisture content of the samples, and moisture loss (ML) and solid gain (SG) were calculated. The curves of moisture loss and salt gain as a function of time were constructed using experimental data. A two parameters model was used for prediction of kinetics of mass transfer and values of equilibrium moisture loss and solid gain. Moisture and solid effective diffusivities were estimated by using Fick’s second law of diffusion. Results and discussion: Results showed that in all of the studied conditions, the levels of moisture loss and solid gain had a non-linear increase with more floatation time in the solution. Moreover, the absorption rate of solid gain was faster in the beginning but eventually slowed down. Azuara model has the potential in estimating the equilibrium points. In addition, a good correlation between predicted and experimental values was obtained by this model. Besides, increasing the concentration of sucrose and Argol from 40% to 50% and 10% to 20% respectively, the coefficient of effective penetration for both parameters (water loss and solid substance absorption) improved. In addition, the coefficient of effective penetration displayed that different levels of sucrose and Argol had a notable effect on this coefficient.

Research Article

Effect of wheat germ oil extracted with microwave pretreatment on the oxidative stability of common Kilka (Clupeonella cultriventris caspia) oil

Pages 777-787

https://doi.org/10.22067/ifstrj.v14i5.67944

Mohammad Taghi Golmakani, Marzieh Moosavi-Nasab, Malihe Keramat, Azin Azhand

Abstract Introduction: Wheat germ is a by-product of wheat milling industry. It contains about 11% oil. Wheat germ oil is well known as a tocopherol rich food lipid. It also contains more than 55% polyunsaturated fatty acids, mainly linoleic and alpha-linolenic acid (Simopoulos 1999; Schwartz et al. 2008). Wheat germ processing presents challenges due to its high content of bioactive compounds. Microwave-assisted extraction is a new extraction technology used for the extraction of bioactive compounds, which is based on combination of microwave and conventional solvent extraction. This technique which is used has many advantages such as short time, less solvent usage, and higher extraction yield (Hao et al. 2002).Common Kilka (Clupeonellacultriventris caspia) oil is considered as one of the most healthy and functional oils. It is highly rich in polyunsaturated ω-3 fatty acids such as eicosapentaenoic acid and docosahexaenoic acid. However, Kilka oil is highly vulnerable to oxidation due to its high content of poly unsaturated fatty acids. Oxidations of poly unsaturated fatty acids such as eicosapentaenoic acid and docosahexaenoic acid result in a number of oxidation products that have negative impacts on the flavor and odor of Kilka oil, and also can affect the amount of these fatty acids that are made available to the body (Lin and Lin 2004; Fazli et al. 2009; Pazhouhanmehr et al. 2015; Yu et al. 2002). In order to preserve polyunsaturated fatty acids of Kilka oil from oxidative degradation, the use of novel and effective antioxidants can offer methods to maintain the health of consumers.The objective of this study was to investigate the effect of microwave-assisted extraction method on extraction yield and some chemical characteristics of wheat germ oil in comparison with conventional Soxhlet method. Also, wheat germ oil was investigated as a natural antioxidant for improving oxidative stability of Kilka oil. Materials and methods: Wheat germ used in this research was supplied from Sepidan Flour Mill (Shiraz, Iran). Crude Kilka oil with no added antioxidants was supplied by a local fishery factory (Rasht, Iran).Wheat germ samples were pretreated with microwave at 200 W for 5 min. Thereafter, the samples were extracted with Soxhlet method. Samples were analyzed at 2, 4, 6, 8, and 10 h of extraction process. Extraction yield, saponification value, acid value, iodine value, and fatty acid profile of wheat germ oil extracted with microwave-assisted method were compared with those extracted with conventional Soxhlet method. Fatty acid composition of wheat germ oil was determined according to the method described by Golmakani et al. (2012) with some modifications. Saponification, acid, and iodine values of wheat germ oil were determined by using the AOAC official methods (AOAC 2000). Wheat germ oil was added to Kilka oil at a concentration of 1000 ppm. For the control, Kilka oil without any added antioxidant was used. Peroxide, anisidine, and Totox values of wheat germ oil were measured during 15 days storage at 60 °C. Peroxide, anisidine, and Totox values of wheat germ oil were determined using the AOCS official methods (AOCS 2000). Induction period was considered as the number of days required for a sample to reach a PV of 20 meq O2/kg (Keramat et al. 2016). Results and discussion: The microwave-assisted extraction method increased the extraction yield of wheat germ oil by 15-27%. Increase in extraction yield is due to cell membrane rupture by microwave which results in greater porosity, enabling the passage of oil from the cell membrane (Uquiche et al. 2008). The amounts of saturated fatty acids, monounsaturated fatty acids, and polyunsaturated fatty acids in samples extracted by microwave-assisted extraction method were similar to those extracted by conventional Soxhlet method. Acid value of samples extracted by microwave-assisted extraction method was slightly higher than those extracted by conventional Soxhlet method. This result is in agreement with the previous studies (Kiralan et al. 2014; Uquiche et al. 2008). The saponification value of wheat germ oil sample extracted by microwave-assisted extraction method was 9.65% higher than those extracted by conventional Soxhlet method. Thus, wheat germ oil sample extracted by microwave-assisted extraction method contained higher short chain fatty acids than those extracted by conventional Soxhlet method. The iodine value of wheat germ oil sample extracted by microwave-assisted extraction method was lower than those extracted by conventional Soxhlet method. Accordingly, microwave-assisted extraction method has a positive effect on the oxidative stability of wheat germ oil. Wheat germ oil significantly decreased the peroxide, anisidine, and Totox values of Kilka oil by 61.59%, 65.01%, and 61.97%, respectively, compared to the control. The induction period and protection factor of Kilka oil sample containing wheat germ oil (120.20 h and 1.42, respectively) was significantly higher than those of control sample (84.40 h and 1.00, respectively). The inhibitory effect of wheat germ oil against Kilka oil oxidation can be attributed to the presence of high amounts of biological active compounds. Based on the results of this study, microwave extracted wheat germ oil can be proposed as a natural antioxidant for improving oxidative stability of Kilka oil.

Research Article

Degradation kinetic of vitamin C (L-ascorbic acid) during simultaneous infrared dry-blanching and dehydration of apple slices with intermittent heating method

Pages 789-802

https://doi.org/10.22067/ifstrj.v14i5.69053

Hassan Sabbaghi, Aman Mohammad Ziaiifar, Mahdi Kashani-Nejad

Abstract Introduction: L-Ascorbic acid (vitamin C) is the most important vitamin in terms of nutrition. Ascorbic acid is a thermolabile (heat-sensitive) compound that can be degenerated aerobically or anaerobically. The degradation rates of ascorbic acid differ with the changes in environmental conditions such as temperature and water activity. It is ascertained that the other nutrients residing in a food can be preserved in case the Vitamin C content is preserved. Thus, the compound is considered as the nutritional quality index during the food processing. The simultaneous infrared dry-blanching and dehydration (SIRDBD) with intermittent heating method is a novel process in which the temperature is kept constant. Over-blanching causes product quality decline and nutrients, especially vitamins, deterioration. Therefore, the precise process conditions (time and temperature) are specified with the objective of preventing over-processing. To do so, such factors as access to the specific center temperature, access to a certain level of enzymatic inactivation and preservation of a given ratio of Vitamin C should be taken into account. This is subject to the biophysical properties of fruits and slices size and shape. The aim of this study was to determine the appropriate operating conditions for blanching step. For this purpose, the effect of irradiation temperature and thickness of the product on the destruction of polyphenol oxidase (enzymatic browning agent) and vitamin C were investigated. Materials and methods: Apple slices (Golden Delicious variety) were prepared with thickness of 5, 9 and 13 mm and 20 mm in diameter. Irradiation was carried out at three constant temperatures of 70, 75, and 80 ° C. The central temperature of the product was recorded during processing. To evaluate the enzymatic activity of polyphenol oxidase (PPO) and its effect on the product color, apple slices were removed from the device in 2- minute intervals and the process was continued till the time no sign of color change stemming from catechol reagent addition was observable. Vitamin C content measurement was carried out with 30- minute intervals during drying till apple slice reaches constant weight. It was performed based on titration by the use of 2, 6-Dichlorophenol-Indophenol (DCPIP). To calculate the browning index (BI) due to PPO activity, image acquisition was made with the use of a flatbed scanner. The treated samples were placed on the scanner and then a black box was utilized so as to prevent the interferences of the peripheral lights and light reflections. The images featured a 300 dpi quality and were saved in TIFF-24 bit format. Color analysis of the obtained images was carried out in color spaces L*a*b* by the use of “color space convertor” pelagin in ImageJ software, version 1.6.0. Statistical analyses were carried out in SPSS software, version 19. To do so and in order to assess the time required time for the blanching, there was made use of completely randomized design (CRD) in factorial format (32) considering two factors, namely thickness (in three levels) and temperature (in three levels). The statistical analyses of the vitamin degradation kinetic constant (k), as well, were conducted based on randomized complete block design (RCBD) in the course of which the temperature and thickness were considered as the block and the treatment, respectively. Mean comparisons were undertaken based on Duncan test in a 95% confidence level (P

Research Article

Evaluation of the effect of nisin, sodium acetate and temperature on the quality of Ctenopharyngodon idella fillet inoculated with Staphylococcus aureus

Pages 803-815

https://doi.org/10.22067/ifstrj.v14i5.69107

Nader Cheraghi, Ebrahim Alizadeh Doughikollaee, Mohsen Shahriari Moghadam

Abstract Introduction: Recently, the high nutritional value of fish and other seafood has caused continuously increasing their consumption in human diet. The meat quality can be decreased during storage due to physical, chemical and microbial changes. Thus, the different methods of preservation should be used to improve the quality and increase the shelf-life of the product. The application of bacteriocinins has been increased to extend the shelflife of food products. Nisin is a kind of bacteriocinins that is produced by Lactococcus lactis bacteria and used as food preservatives. It is accepted such as food additive in many food commodities. Bacteriocinins showed synergistic effects when they used with other antibacterial compounds such as natural preservatives and phenolic compounds. Literature review showed that the antibacterial compounds such as sodium acetate play an important role in preventing the growth of bacteria and increasing the shelf life of fish during different storage conditions. Conventional optimization procedures are performed by altering one parameter at a time and keeping all other parameters at fixed levels. However, these procedures are time consuming and require more experimental data sets. Recently, the use of an orthogonal array approach called ‘Taguchi method’ has been successfully examined in the different field of sciences. Therefore the aim of this research was to investigate the effects of nisin, sodium acetate and temperature on the growth of Staphylococcus aureus in Ctenopharyngodon idella fillet using Taguchi experimental design with an array L4 (23). Materials and methods: The fresh Ctenopharyngodon idella with weight of 1 kg were purchased from market (Zabol, South east of Iran) and transported in isothermal iceboxes to the fish product processing laboratory at University of Zabol in 2016. The fishes were cleaned and filleted. Fillets after inoculated with Staphylococcus aureus (103 Log CFU/g) and added nisin (750 and 1000 IU/g) and sodium acetate (1 and 2 %) were stored in different temperatures (4 and 8 °C). Chemical parameters (pH, PV, TBA and TVB-N) and Staphylococcus aureus count were measured at 0, 3, 6 and 9 days. Microscopic analysis was used to observe the microstructure changes at end of storage. The experiments were performed in three replicates. Results & discussion: The present study showed that the lowest and highest Staphylococcus aureus growth was observed in treatment 2 (sodium acetate 2%, nisin 750 IU/g, temperature 4°C) and control at 4 and 8° C, respectively. It is noticeable that the growth of Staphylococcus aureus decreased in treatment 3 (sodium acetate 2%, nisin 1000 IU/g, temperature 8° C) during storage at 8° C. Also, the results showed that the temperature was most important factor on the growth of Staphylococcus aureus in the beginning of experiment and the other factors showed their effect during storage. Therefore, the highest and lowest effect was related to temperature and nisin at the end of experiment, respectively. In the present study, the additives could be prevented the growth of bacteria with except in treatment 4 (sodium acetate 1%, nisin 750 IU/g, temperature 8° C). The inhibitory effects of nisin and sodium acetate on the growth of Staphylococcus aureus was better shown with increasing storage time. The TVB-N of fillets increased during storage but this increase was lower in treatment 2 than the other treatments. The temperature and nisin had a significant effect (p

Research Article

Effect of pomegranate flower extraction and vitamin B3 on the roasted doughnut’s durability and sensory features

Pages 817-827

https://doi.org/10.22067/ifstrj.v14i5.69495

Mahin Heydari Ashkezari, Mania Salehifar

Abstract Introduction: One of the useful methods to increase the roasted product’s durability is the addition of antioxidants. The antioxidants can replace the synthetic antioxidant in doughnut. One of the problems related to doughnut is oxidative corruption in industrial type. The purpose of this study was to extract pomegranate flower extraction and use of vitamin B3 as two natural antioxidants in doughnuts. Materials and methods: In this study, the effect of three variation such as pomegranate flower extraction (0.07, 0.55 and 0.04 percent), vitamin B3 (1.5, 1.9 and 2.3 percent) on oxidation features (peroxide index, acidity, anisidine, totox and Thiobarbituric acid), tissue obstruction and sensory evaluation (taste, tissue, color, scent and total acceptance) were evaluated and analyzed in the research. The mean comparison of examined samples was carried out using RSM method and central cube design (CCD). Results & discussion: The obtained results showed that adding pomegranate flower extraction and vitamin B3 to doughnut caused significant decrement of peroxide index, anisidine, totox, acidity and Thiobarbituric acid in 15th day. While tissue stiffness increased with increasing vitamin B3 on the 15th day. The sensory evaluation also expressed that increasing pomegranate flower extract’s percentage and vitamin B3 decreased total acceptability in all sensory features. Results of optimization showed the doughnut samples containing 0.07% pomegranate flower extraction and 1.97% vitamin B3 were accepted as the closest samples to the control sample and as the foremost treatment from sensory and durability point of view.

Research Article

Evaluation of antimicrobial Activity of Two Lactobacillus Strains Isolated from Traditional Motal Cheese on shelf life of Yoghurt drink (Doogh)

Pages 829-846

https://doi.org/10.22067/ifstrj.v14i5.70645

Saeid Afzali, Mohammad Reza Edalatian Dovom, Mohammad Bagher Habibi Najafi, Mostafa Mazaheri Tehrani

Abstract Introduction: Yoghurt drink or Doogh has gained great attention in recent years in different countries. On the other hand, this desirable commodity has showed some drawbacks especially from microbial point of view. One of the main problems in Doogh production and storage is considered to be the presence and activity of gas producing microorganisms especially in warm conditions and environments. From the consumer point of view, blowing of container is not acceptable and is regarded as a defect. Since lactic acid bacteria (LAB) possess the potential use as adjunct or co-culture in fermented dairy products for inhibition of gas – producing microorganisms’ especially gas-producing yeasts in doogh, inclusion of these bacteria (LAB) can be a solution for this problem in aforementioned product. In this study, antimicrobial effects of two selected strains of Lactobacillus brevis assigned as M2 and M4 isolated from Motal cheese were investigated on the gas-producing and food spoilage microorganisms in Doogh. Materials and methods: Two strains of lactobacillus namely M2 (Lactobacillus brevis KX572376) and M4 (Lactobacillus brevis KX572378) were selected from traditional Motal cheese isolates. Doogh production was carried out according to National Iranian Standard No. 2453. Each of these two strains was inoculated in Doogh at two levels of 106 and 108 cfu / ml and control sample was taken without inoculation followed by subjecting to microbial and sensory analysis at three temperatures of 4, 25 and 37°C, at intervals of 10, 7 and 7 days, respectively. Microbial profiles including coliforms, E. coli, Mold & yeast and Staphylococcus aureus were determined according to National Iranian Standard Number (2 and 1) –5486, 5234 and 5486, 997 and 6806, respectively. Sensory evaluation was carried out according to Iranian National Standard No. 4691. Sensory evaluation parameters such as taste, texture, color and total acceptance were evaluated by 10 senior food industry students. Results and discussion: The results showed that sample inoculated with M4106 strain, received the highest score for antimicrobial activity at all three storage temperatures. Results demonstrated that, at 4 ° C, the control sample was contaminated (spoiled) on 50th day and was positive for mold and yeast count, but sample inoculated with M4106 was acceptable (negative) for mold and yeast count. At 25 C, mold growth was detected in control sample on the 14th day of storage, but the sample inoculated with M4106 remained completely un-spoiled until the 21st day. At 37°C, the control sample on day 7 was positive for mold and yeast count, but the sample inoculated with M4106, mold and yeast was not detected until the 14th day. Coliform, Staphylococcus and Escherichia coli counts in M4106 sample were negative. Sensory evaluation was carried out according to Iranian National Standard No. 4691.Sensory evaluation data showed that samples inoculated with M4106 were superior to the control sample. Doogh samples inoculated with Lactobacillus brevis strains experienced acceptable sensory evaluation so that they gained better score than control sample. The highest score was obtained for the M4106 sample. The texture of the Doogh samples showed a decreasing trend at all three temperatures during the storage period. Moisture and pH are factors influencing texture changes during the initial stages of storage. Based on the taste evaluation results, at 4°C, the highest score was related to M4108 until day-20, but from the 20th to the 60th day of storage, the M4106 has gained the highest one. At 25°C until day 7, the highest score belonged to sample M4108 but from this day on, M4106 has been more favorable. At 37°C on production day, highest score for the M4108 sample but on day- 7 and 14, the M4106 took the highest score. Regarding to color index, M2108 has gained the highest score at all 3 temperatures on the production day and for the rest of storage time, the highest scores were obtained for the M4108 and M4106 samples. Maximum total acceptance, was obtained for M2108 on the production day but this was replaced by M4106 for the rest of the time .The results showed that the Lactobacillus strain M4106 strain had the highest antimicrobial activity and the optimum score for sensory evaluation, as well as a significant increase in Doogh shelf life and reduced gas production in the bottle.

Research Article

Cookie from extruded sorghum flour: Effect of extrusion and freezing conditions on frozen dough and cookie quality

Pages 847-864

https://doi.org/10.22067/ifstrj.v14i5.70942

Nasim Hasanpoor, Mohebbat Mohebbi, Arash Koocheki, Elnaz Milani

Abstract Introduction: Nowadays, frozen dough technology is used to produce bakery, pastry & cakes products. On the other hand, extrusion plays a role as a high-performance process in the food industry, which, given its unique characteristics, can replace many common methods of food processing. This study was carried out aimed to investigate the effect of freezing methods (slow and rapid) and the storage time of frozen dough under freezing conditions on physicochemical and sensory properties of extruded and non-extruded sorghum flour for producing a gluten-free product suitable for Coeliac patients. Materials and methods: In this study, extruded sorghum flour (an extruder with a temperature of 150-160°C, a moisture content of 14%, a speed of 150 rpm, feeding of 40 grams per minute and circular matrix with a diameter of 5 mm and, in the last step, using a grinding mill and 0.599 mm mesh, flouring is done), non-extruded sorghum flour (100%), Xanthan gum (1% w/w) were used in cookie dough formulation. Two types of slow and fast freezing were used to freeze the dough of cookie. Slow freezing according to the method provided by X.u et al. (2009) and Ke et al. (2013). In a fast freezing method, rapid cooling rooms were used at -40°C for 30 minutes. After freezing, the samples were placed in polyethylene bags and stored for 0, 2, 4, 6 and 8 weeks in a refrigerator at -18°C (X.u et al., 2009). For the thaw process, dough pieces were placed in a refrigerator at + 4°C for 16 hours (Maizani et al., 2012). Baking was performed in a microwave oven at 180°C for 14 minutes. The properties of the final product, such as the ratio of expandability (AACC 10-52), textural properties (cookie texture were carried out using a TA.XTplus Texture Analyzer (Walker et al, 2012)), total gelatinization and enthalpy temperature(Using the DSC device and temperature range 7-157°C and heating temperature 10°C/min), color, percentage of porosity, shell thickness (Image processing technique and ImageJ software) and sensory evaluation were investigated in a completely randomized factorial. Statistical analysis of the results was done using a factorial arrangement of completely randomized design and comparison of the meanings using Duncan's multiple range tests at 5% level. Data analysis was performed with three replications using SPSS 18 software. Results & discussion: The gelatinization temperature decreased with increasing times of storage; however, the total enthalpy of the process was increased. The results showed that with increasing freezing rate, the gelatinization temperature increased significantly (P≤0.05), and the total enthalpy of the process decreased and the cookie from frozen dough containing extruded sorghum flour has the highest gelatinization temperature and the minimum total enthalpy value. With increasing times of storage, the dough chewiness decreased significantly (P≤0.05) and the adhesion and stiffness of the dough texture increased. The dough chewiness increased with the increase in the freezing rate, however, the adhesion and stiffness of the dough texture decreased and cookie dough containing extruded sorghum flour resulted in a significantly higher chewiness and lower adhesion and stiffness (P≤0.05) of the texture compared to the non-extruded sorghum cookie flour in both methods of freezing. The extensibility ratio has significantly decreased (P≤0.05) with increasing the times of storage. The extensibility ratio of cookie was significantly increased with the increase in freezing rate (P≤0.05) and non-extruded sorghum flour samples showed a lower extensibility ratio relative to the extruded sorghum flour cookies. The dough freezing method also had a significant effect on the final cookie quality (P≤0.05). The stiffness of the cookie texture from the frozen dough decreased by increasing the dough freezing rate and its tissue was softer and cookie samples containing extruded sorghum flour have a significantly lower tissue stiffness compared to other samples. The stiffness of the cookie tissue increased significantly (P≤0.05) with increasing times of storage. L* parameter (lightness) significantly decreased (P≤0.05) with increasing the times of storage and decreased the yellowness factor (b*) and increased the redness factor (a*) significantly (P≤0.05) for the cookie made from frozen dough. The freezing rate had a significant effect (P≤0.05) on the lightness of the cookies. The parameters L* and b* decreased by increasing the freezing rate and the colors of these cookies were darker. Cookies containing extruded sorghum flour had the lowest level of L* and b* and highest level of a*. The porosity% and thickness of crust of cookie decreased significantly (P≤0.05) with increasing times of storage. These parameters increased significantly with increasing freezing rate (P≤0.05) and tissue porosity and thickness of crust of cookies obtained from the frozen dough containing extruded sorghum flour was significantly higher (P≤0.05). The results of the kinetics of cookie mass transfer from frozen dough showed that the effective moisture diffusivity of cookie was reduced by increasing times of storage. Overall, the results showed that the process of extruding sorghum flour has improved the physicochemical properties of the cookie, and the fast freezing process improves the quality of the cookie made from frozen dough, and in this condition extruded flour sorghum can be used as a suitable alternative to wheat. Also, the use of frozen dough for cookie production can be a good way to supply this product.

Research Article

Effect of feed mixture and process variables on physicochemical properties of solid foams made from corn starch and sesame seed by extrusion

Pages 865-876

https://doi.org/10.22067/ifstrj.v1396i0.63179

Shahram Beiraghi-Toosi, Mohebbat Mohebbi, Mehdi Varidi

Abstract Introduction: Extrusion is one of the technologies used for solid foams production. In this process, pressure is the most important parameter and the most important variables affecting pressure are feed mixture, die diameter, barrel temperature and screw speed. A reduction of die diameter or plasticizer contents such as moisture and fats in the feed mixture or an increase in the screw speed or barrel temperature can increase the extruder barrel pressure. Also, the increased barrel temperature, in addition to changing cooking properties, escalates the temperature difference inside and outside of the die, raising the rate and amount of evaporation from melted mixtures, therefor affecting the solid foam structure and characteristics. On the other hand, the type and amount of feed mixture components are key factors affecting the extrudate properties (Moraru et al., 2003; Plews et al., 2009; O’Shea et al., 2014). Sesame seed is one of the ancient edible oil seeds used in many food products. In addition to oil, it contains carbohydrate, protein and fiber (Namiki et al., 2001) which can provide a variety of compounds in the feed mixture to change the properties of foam. This study investigates the effect of partial replacement of corn starch with edible oil seed containing a mixture of various compounds and the effect of the extrusion process on the changes in the physicochemical properties of the produced solid foam relative to the foam produced from corn starch. In this regard, different proportions of sesame seeds were added to the corn starch with specific moisture contents, and following the application of the extrusion process, the effect of feed mixture, operation temperature, screw speed and die diameter on physicochemical properties of solid foams was evaluated. Materials and methods: Solid foams made from corn starch with 0, 10, 20 and 30 percent of sesame seed in the formulation and 15 percent of moisture content were processed in a co-current twin-screw extruder at a screw speed of 120, 150 and 180 rpm, a barrel temperature of 120, 145 and 170°C, a die diameter of 2.5 and 4 mm, and a constant feed rate of 40 kg per hour. A completely randomized design was employed to investigate the effect of these variables on chemical and physical properties of extruded products. The moisture content of samples was measured using oven method at 105°C (AOAC, 1990). Water absorption and water solubility indices were measured through solving the sample powder in distilled water, which was followed by centrifuging, weighing gel, drying supernatant and weighing dried matter (Singh et al., 2015; Huang et al., 2014). In addition, particle density was measured using the rapeseed displacement method (Singh et al., 2015) and solid density was calculated by the weight /volume ratio of the sample powder, as measured by the gradient cylinder (Ushakumari et al., 2004; Yagci et al., 2008). The porosity of samples was measured in terms of the ratio of particle density to solid density (Plews et al., 2009; O’Shea et al., 2014) and the radial expansion ratio was calculated in terms of the ratio of sample diameter, as measured by the caliper, to die diameter (Chanlat et al., 2011; Huang et al., 2014). Results and discussion: Results showed that adding 10% sesame seed, due to the variety of compounds and their increased interactions, produced foams of maximum expansion and porosity, and minimum particle density. Adding 30% sesame seed had an opposite effect due to increased fat content and reduced pressure effect on the melted mixture in the barrel. Moreover, increased die diameter demonstrated augmented residual moisture content, water absorption index, density and porosity, as well as decreased water solubility index and expansion ratio of solid foams caused by pressure reduction on the melted mixture in the barrel. The increased barrel temperature was associated with greater changes in cooking, escalated temperature difference between inside and outside of the die and production of foams with higher water solubility index and expansion ratio, as well as lower residual moisture content, water absorption index and solid density. The higher screw speed increased the applied energy, and despite decreasing the time of temperature effect, produced foams with properties comparable to those caused by temperature increase. In general, it can be stated that the process factors that raise the energy applied to the extrusion material leads to the increased water solubility index and the expansion ratio of the solid foams and decreased residual moisture, water absorption index and density. Consequently, by selecting the right type and amount of feed mixture to create proportions in various compounds and determine the appropriate process conditions, solid foams with desired properties can be produced by means of extrusion using available raw materials.

Research Article

Optimazation of thin layer drying conditions of saffron petal using Response Surface methodology

Pages 877-889

https://doi.org/10.22067/ifstrj.v14i5.67570

Parvin Sharayei, Hossein Chaji

Abstract Introduction: Saffron (Crocus sativus) is the most expensive kind of spice in the world while around 400 tons of saffron are estimated to be produced in the current Iranian year (March 2016-17) from 90,000 hectares of land under saffron cultivation across the country. But, high share of producing saffron is exclusively dedicated to produce and dry saffron stigma as whereas their violet color petals are mostly ignored and disposed. Saffron petal is one of the most economical sources of anthocyanin pigments. Attractive colour, functional properties and antioxidant properties of anthocyanins can make them a good substitute for synthetic pigments in the food industry. But, due to high moisture content of petals, 96.36% db, they must be dehydrated immediately to prevent the decay. In the meanwhile, the drying conditions are also too critical to petal sensitive compounds while the method of drying along with drying period and the amount of energy consumed, obviously play a significant role on price and quality of the final product. Materials and methods: In this study, the optimization of the thin layer drying conditions of saffron petal was investigated using response surface methodology (RSM) and Face Centered Experimental Design (FCED) in order to designate the empirical expriments. Saffron petals were dried at different temperatures (40, 50 and 60◦C) and air velocities (0.7, 1.4 and 2.1 m.s-1) in a thin layer dryer and quantitative and qualitative characteristics of saffron petals (color )L: brightness; a: red – green; and b: blue-yellow, total phenolic compounds (TPC), total anthocyanin components (TAC), scavenging activity of DPPH (RSA), ferric reducing-antioxidant power (FRAP) and minimized 50% of radical-scavenging activity (IC50) contents) were invetigated. Results & discussions: Maintaining the quality of final dried product as high as possible is a major concern while it is an important aspect to consider for use of phenolic compounds and anthocyanins as antioxidants and colorants in food industry. The results showed that the total phenolic compounds (TPC) and total anthocyanin content (TAC) had a remarkable increase with temperature rise from 40 to 50◦C while more temperature increase brought about sharp drops. But, an increasing trend of variations is observed in parallel with increases in velocity of drying air for each temperature. The rise in anthocyanin and phenolic content is more attributed to much significant reduction in drying duration from 40 to 50◦C in comparison with 50 to 60◦C. It was also observed that total antioxidant activity of dried saffron petals showed the same response as TPC and TAC to temperature rise from 40 to 50◦C. Such behaviour could be explained by the findings of other researchers in which the antioxidant activity has high correlation with anthocyanin content and total phenolic composition of food materials. As a complementary, it can be mentioned that polyphenols in an intermediate stage of oxidation have greater antioxidant power than initially even though this is temporary; furthermore high temperature stabilization procedures may lead to the formation of new compounds with higher antioxidant activity. This is essentially the case of the Maillard reaction, which creates various Maillard reaction products, with markedly higher antioxidant power. Conclusion: Generally, according to Derringer’s desired function approach, the optimal conditions were 50◦C and 1.4 m.s-1.The experimental values agreed with those predicted values. At this optimum condition, the TPC, TAC, DPPH, FRAP, and a value of the dried saffron petal were found to be 46.39 mg/ g ,1205.58 mg/l, 52.97%, 1276.52 µmol Fe2+/l, and 11.13, respectively. The experimental values were in a good agreement with the predicted values.

Research Article

Effect of feed mixture and extrusion temperature on physicochemical and sensory properties of barley flour- carrot pomace snack

Pages 906-991

https://doi.org/10.22067/ifstrj.v14i5.68582

Sorour Lotfi Shirazi, Arash Koocheki, Elnaz Milani, Mohebbat Mohebbi

Abstract Introduction: Snack foods have become an important part of the people’s diets. During last decade demands for utilization of fruit and vegetable waste in order to their dietary fibers in value added food products has been increased. Carrot pomace is rich in dietary fiber that contains important functional and nutritional properties. Barley contains a high amount of dietary fiber, especially soluble fiber, which has essential role in reducing blood cholesterol level. Materials and methods: In this project based on Central Composite Design, the effect of independent variables containing extrusion temperature (120-170 °C), moisture content (14-20%) and carrot pomace level (10-25%) were evaluated on expansion ratio, bulk density, WAI, WSI, hardness, color snacks were evaluated by panelists in terms of acceptance or non-acceptance. Results and discussion: Results expressed that expansion ratio, lightness, total acceptability and WAI decreased by increasing the amount of carrot pomace. Reduction of expansion ratio and WSI and improvement of lightness and WAI were shown as increased in moisture levels. The hardness and bulk density decreased with an increase in temperature. When temperature increased up to 145°C, expansion ratio, lightness, WAI and WSI increased and decreased thereafter. The optimum conditions for barley flour-carrot pomace snack were determined at the maximum expansion ratio, L*, WAI and overall acceptability with minimum bulk density and hardness in a snack. The optimum condition provides the highest value of expansion ratio 296.1 (%), L* 65.087, WAI 4.931 (g/g) and overall acceptability 4.502 with lowest bulk density 1.22 (g/cm3) and hardness 6.756 (N). Accordingly, the optimum conditions for the snack are 10% carrot pomace, 148°C die temperature and 15.49% moisture. The approximate composition of the snack extruded and unextruded obtained under the optimal conditions. Extrusion did not affect the protein and ash contents but it decreased the fat content of snack. During the extrusion, the SDF increased from 7.63 to 9.27 g/100g while the IDF decreased from 5.24 to 3.71 g/100g. Extrusion cooking did not affect the TBG content in barley flour-carrot pomace snack. Extrusion cooking resulted in the conversion of insoluble to soluble fiber and well balance of both types of the fiber

Research Article

Producing and optimizing the properties of chitosan-organic nanofiber biodegradable nanocomposite based containing O. vulgare subsp. gracile and C. copticum essential oils and its application on the oxidative stability of Canola oil

Pages 907-927

https://doi.org/10.22067/ifstrj.v14i5.71229

Eisa Jahed, Hadi Almasi, Mohammad Alizadeh khaled abad

Abstract Introduction: Due to increasing attention to the environment, as well as consumer demand for healthy, nutritive food products and extended shelf life, in the recent years, the food and packaging industries have paid increasing attention to biodegradable edible packaging prepared from biopolymers such as proteins, polysaccharides, and lipids or their combinations. These biodegradable films may act as carrier of wide variety of additives, such as antimicrobial, antioxidant agents, flavors, colorants and spices which improve the functionality of the packaging materials by addition of novel or extra functions. In the present study, an antioxidant/antimicrobial active packaging based on chitosan biopolymer was designed. For this purpose, lignocellulose nanofibers (LCNF) and cellulose nanofibers (CNF) at concentration of 4% were used as reinforcement of biopolymer properties, as well as to control the release of Origanum vulgare subsp. gracile and Carum copticum essential oils (as antioxidant/antimicrobial agent) from the packaging material into the foodstuff. Materials and methods: The O. vulgare ssp. gracile leaves and C. copticum seeds were obtained from wild plants in mountains of Urmia (Iran). LCNF (average diameter about 55 nm, average length about 2–5 μm, 99% purity) produced from unbleached hardwood pulp through mechanical and acid treatments and CNF (average diameter about 28 nm, average length about 2–3 μm, 99% purity) prepared from softwoods through mechanical disintegration were kindly provided by Nano Novin Polymer Co. (Saari, Iran). Chitosan (medium molecular weight, from shrimp shell with a deacetylation degree of 75–85%), purchased from Sigma-Aldrich (St. Louis, MO, USA). Chitosan based bionanocomposite films incorporated with organic nanofillers and essential oils were developed by solvent casting method. The synthesized films were characterized by XRD and DSC analyses. To determine the prepared films would have potential to be used as an active packaging, water vapor permeability, water solubility, color, transparency, mechanical properties, antimicrobial and antioxidant activity of the films were also evaluated. In order to determine the efficiency of activated nanocomposites, the effect of these films was evaluated on the oxidative stability of rapeseed oil without antioxidants and compared with the effect of TBHQ synthetic antioxidant. Results & Discussion: The results showed that the addition of essential oils did not have a significant effect on the crystallinity and thermal properties of the films, while organic reinforcement increased the crystalline properties and thermal resistance of nanocomposite films. By applying the essential oils and CNF and LCNF in the structure of the films, the apparent transparency and consequently the amount of light passage from them decreased compared to the control sample. With addition of essential oils separately and in combination, as well as CNF and LCNF in the structure of films, solubility and film permeability decreased compared to pure chitosan film. By adding of two essential oils with a ratio of 50:50, tensile strength (UTS) and strain to break (STB) of films were increased, while organic nanofibers led to an increase in UTS and a significant reduction in STB of nanocomposites. It was also found that active films containing different ratios of essential oil had remarkable antioxidant activity and high antimicrobial activity against E.coli and B.cereus bacteria, which by adding CNF and LCNF these features were reduced due to the role of controlling the release of essential oil compounds by nanofibers. With the numerical optimization of the software, the optimal amount for the essential oils of C. copticum and O. vulgare oils were 2.29 and 2.71% (5% mix) respectively, in combination with the LCNF nanofibers. The results of oxidative stability of Canola oil showed that nanocomposites containing 5% essential oil were considerably able to keep the oil freshness during storage at ambient temperature and delay the oxidation of the oil.

Research Article

Evaluation of the stability, color, and viscosity for whey protein-pectin nano complexes as nano carriers of orange peel oil

Pages 929-943

https://doi.org/10.22067/ifstrj.v1396i0.62600

Sanaz Ghassemi, Seyed Mahdi Jafari, Morteza Khomeiri, Elham Assadpour

Abstract Orange peel oil,a widely used industrial flavoring, is volatile and chemically unstable in the presence of air, light, moisture and high temperatures. Biopolymer Nano complexes, a bunch of Nano carriers, are produced between groups of charged polysaccharides and proteins with the use of electrostatic interactions. The nanoparticles are able to carry, protect, and increase their bioavailability of food-drug materials. Hence, in this study, the Nano complexes of pectin- whey protein concentrate, as a carrier of orange peel oil, were produced and the features of prepared Nano complex solution with various concentrations of whey protein (4, 6 and 8%), pectin (0.5, 0.75 and 1%) and different values of pH (3, 6 and 9) were studied. The Viscosity, stability and color (index L *) of the treated designs, done in a response surface methodology, were examined. The results showed that whey protein 4% and pectin 1%( with a pH of 3 and 9) had the lowest and highest stability respectively. Also this treatment with a pH of 3 showed the highest viscosity as well as the highest L *. The lowest viscosity was achieved by whey protein 6% and pectin 0.75% with a pH of 3, and because of the unbalanced compound, the complex did not form and a phase separation occurred. The lowest L * was obtained by whey protein 4% and pectin 0.5% with a PH of 9. Ultimately, whey protein 4% and pectin 1% with a PH of 3 were selected as the optimum sample because of formation the strong and suitable complex. Particle size and zeta potential measurement of optimum sample, were 160 nm and -0.53 mV respectively.