Food Technology
Bahareh Nowruzi
Abstract
Introduction
Intelligent food packaging as a new technology can maintain the quality and safety of food during its shelf life. This technology uses indicators and sensors that are used in packaging and detects physiological changes in food (due to microbial and chemical degradation). These indicators ...
Read More
Introduction
Intelligent food packaging as a new technology can maintain the quality and safety of food during its shelf life. This technology uses indicators and sensors that are used in packaging and detects physiological changes in food (due to microbial and chemical degradation). These indicators usually provide information that can be easily identified by the food distributor and the consumer. However, most of the markers currently used are non-renewable and non-degradable synthetic materials. Microalgae that live in both marine and freshwater are a versatile solution for building new biosensors to detect pollutants such as herbicides or heavy metals. These photosynthetic microorganisms are very sensitive to their environmental changes and allow the detection of pollutants. In the past few years, several studies have been conducted in relation to the development, evaluation and application of biosensors using natural compounds in smart food packaging, and some of them are reported and summarized in Table 2.
Materials and Methods
In these studies, examples are mainly focused on biosensors related to biopolymers, but some other synthetic polymers that are easily degraded have also been used as examples. In Table 2, it is also specified what the function and application of the sensor is and how it reacts to the loss of freshness of food. Most sensors are sensitive to the change in pH caused by the release of volatile nitrogen compounds, and this change is characterized by a colorimetric response. Sensors are usually placed in the space above the food container, avoiding direct contact with the food, but close enough to detect changes in the environment and respond to changes in food quality. When these biosensors are integrated with biopolymers, they are usually incorporated into the polymer structure, and the color change of the layers (film) indicates changes in food quality in the packed product. The collected information also clearly shows that extracts rich in chemical compounds of pigments that change color with pH and especially anthocyanins have been used in these biosensors. In addition, most studies of biosensors have been conducted on fish, meat, and seafood, which is probably because their quality degradation is an important economic loss and also because the pH of the surrounding environment is changed during the degradation process. , and this change is easily detected through pH-sensitive biosensors. Smart food packaging technology has made it possible to monitor food quality by incorporating markers, sensors and radio frequency identification (RFID) into packaging. The technology also allows producers and consumers to trace the history of a product through important points in the food supply chain.Interestingly, some compounds applied and tested in the sensor not only provide a pH-sensitive dye, but also have other bioactive properties, for example, antimicrobial properties, and its presence in the polymer matrix can also increase the storage activity of packaging materials.
Results and Discussion
This paper shows that microalgae can be used as biosensors to detect pollutants such as herbicides, heavy metals and volatile organic compounds. These biosensors are very sensitive and reproducible for physical or chemical analysis. One of the main advantages of these microalgal biosensors is that repeated measurements can be performed without extensive sample preparation. They can also be selective, for example chlorophyll fluorescence emitted from photosynthetic activity allows the detection of herbicides, while inhibition of alkaline phosphatase and esterase allows the determination of heavy metals and organophosphate insecticides. Recently, great progress has been made in the identification of genes and related pathways in microalgae, and powerful techniques for genetic engineering have been developed. Collectively, the progress achieved in these areas will rapidly increase our ability to genetically optimize the production of more sensitive microalgae-based biosensors.
Arezoo Hashemnia; Vahid Hakimzadeh
Abstract
Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields ...
Read More
Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields which, when they interact with electromagnetic resonance radiation, their radiant properties rises sharply. This process causes the absorption process of these nanoparticles to be several times stronger than the absorption process of the strongest adsorbent molecules and their scattered light is several times more intense than the organic materials fluorescence. These unique properties provide a high potential for these nanoparticles to be used in many applications such as biochemical sensors, biomedical imaging and medical treatments. Aptamers are single-stranded oligonucleotides, DNA, RNA or proprietary proteins that have the ability to attach specifically to their target. The basis for identifying the target by aptamers is the third structure formed by them. One of the important benefits of aptamers to antibodies is their smaller size, which makes them more easily and effectively penetrated. It also has neither toxicity nor immunogenicity unless in very low levels. Therefore, biosensors that use aptamers as biological identifiers are known as aptasensors. In this research, due to the high losses caused by aflatoxins to the crops and their toxicity, the rapid detection of these pesticides by aptasensor method was investigated. Materials and methods: The test was carried out in a 96-well plate and for each concentration three replicates were considered. In each test, 100 μl of the nano gold solution, which was centrifuged twice at 12000 rpm and at room temperature, was thrown into 11 concentrations and three repetitions in the plate houses. Then adding 15 μlit of aptamer at a concentration of 5 μmol plus 10 μlit of distilled ultrapure water to the houses and incubate for 30 minutes at room temperature. After this time, 25 μlit of different concentrations of aflatoxin plus 15 μlit of 2 molar salt solutions and 35 μlit of distilled water were added to the houses and, after mixing (up and down) in the ELISA reader, absorbed it we read. Results and discussions: At first, with adding the aptamer to Nano gold particles a complex between nanoparticles and aptamer is created. But in present of suitable aflatoxin, the complex of nanoparticle and aptamer is separated and a new complex between aflatoxin and nanoparticle is formed. Subsequently the color is changed to purple. This color change is visible to the eye, indicating that the Aptamer is suitable for Target. In this study, it was found that an aptamer with GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA sequence only affects aflatoxin G1 and other aflatoxins such as B1, B2, and G2 should be considered as another sequencer for Aptamer.
