with the collaboration of Iranian Food Science and Technology Association (IFSTA)
Volume & Issue: Volume 15, Issue 4 - Serial Number 58, September and October 2019 
Research Article

The effect of wheat germ powder on physicochemical, microbial and sensory properties of kefir beverage

Pages 395-406

https://doi.org/10.22067/ifstrj.v15i4.76680

Soheila Ahmadian Mask, Farideh Tabatabaei Yazdi, Seyed Ali Mortazavi, Arash Koocheki

Abstract Introduction: Kefir is a traditional beverage produced by fermented milk with kefir grains, which is becoming increasingly popular throughout the world due to its health benefits and disease prevention properties beyond its basic nutritional value. The grains contain a mixture of complex microflora such as lactic acid bacteria, yeast and sometimes acetic acid bacteria which are lodged by a polysaccharide matrix calls “kefiran”. Kefir is a self-carbonated beverage that owes its distinctive flavor to a mixture of lactic acid, ethanol, carbon dioxide and other flavor products such as acetaldehyde and acetone. Kefir has been recommended for the treatment of several clinical conditions such as gastrointestinal problems, hypertension, allergies, and ischemic heart disease. Kefir grain fermentations from various substrates have been evaluated and a wide variety of bioactive compounds have been observed, such as organic acids, CO2, H2O2, ethanol, bioactive peptides, exopolysaccharides (kefiran), and bacteriocins. These compounds may act independently or together to produce the various health benefits attributed to kefir consumption. Nowadays, its popularity has been expanded worldwide and it is considered as a healthy product with high nutritional value in Europe, Asia, and South and North America. Wheat germ, corresponding to 2–3% of the total weight of wheat kernel, is almost systematically removed during milling since it adversely affects the keeping and processing quality of the flour. Wheat germ (WG) is widely recognized as a nutritious raw material for incorporation into food product formulations or as an independent food product. Wheat germ, containing about 8% - 14% oil (average 10%), is mainly used in food, medical and cosmetic industries as a source of oil. Unfortunately, the whole quantity of the germ produced in Iran is currently utilized in the production of animal fodder. According to chemical analyses, wheat germ contains magnesium, zinc, calcium, selenium, sodium, potassium, phosphorus, chromium, antioxidants including beta-carotene (for vitamin A), vitamin E, vitamin C, vitamin B12, vitamin B6, thiamin, riboflavin, niacin, folic acid, iron, amino acids, and enzymes, and has a high dietary and medicinal value. The purpose of this study was to investigate the effects of various concentrations of wheat germ powder on physicochemical, microbial and sensory properties of kefir beverage.
 
Materials and methods: A commercial freeze-dried Kefir starter culture (ABT_2) was purchased from Chr. Hansen (Denmark) also Saccharomyces cerevisiae was supplied from Saf-Levure (France). Cow milk were obtained from the Department of Food Engineering, Ferdowsi University of Iran. Wheat germ was supplied from Isar Qaynat Co. All chemicals were from Merck Co.
Steam stabilized wheat germ powder at 1, 2 and 3% levels with DVS starter and Saccharomyces cerevisiae at 25 ° C were transferred to full fat cow’s milk and the fermentation was ended at pH 4.6. Microbial, physicochemical and sensory tests were performed at 24, 48 and 72 hours after inoculation. The pH and acidity of kefir were determined according to National Iranian Standard Number 2852. The viscosity was also determined using a Brookfield viscometer (spindle 3, USA) at the temperature of 5°C and a shear rate of 80.0 1/s. Spectroscopic measurement of alcohol was performed according to Sayyad et al. (2015). Lactobacilli counts were performed on MRS medium at an incubation temperature of 37°C for 3 days. Yeasts counts were carried out on YGC at an incubation temperature of 25°C for 5 days. Total counts were performed on PCA at an incubation temperature of 30°C for 2 days. All statistical calculations were completed using the Minitab Version 16. Analysis of variance (ANOVA) was carried out using the general linear model (glm) procedure and Tukey test was used to determine the differences among means.
 
Results and discussion: Wheat germ is a by-product derived from the wheat milling industry and is a rich source of vitamins, proteins, dietary fiber and minerals. Due to its antioxidant, sterol and essential amino acids contents, it has a lot of health effects and is known as a nutritious raw material for its composition in food formulations. Therefore, in this study it was used to produce kefir beverage to produce a high-nutritional product. Based on the obtained results, increasing the percentage of wheat germ powder concentration on the physicochemical, microbial and sensory properties of kefir beverage has a significant effect. The sample containing 3% wheat germ powder showed the highest acidity, ethanol, yeast and total microbial count, during the storage period, acidity, ethanol and yeasts increased in all samples, while pH, Lactobacilli, total microbial count and apparent viscosity had decreasing trend and samples of kefir containing wheat germ powder showed non-Newtonian flow behavior according to the power law model. On the other hand, the apparent viscosity of the samples significantly decreased with increasing wheat germ concentration. According to the sensory evaluation results, kefir produced with one percent wheat germ received the highest overall score within 72 hours after inoculation.

Research Article

The effect of incorporating of ZnO/ Ag nanoparticles on functional properties of poly vinyl alcohol packaging films

Pages 407-417

https://doi.org/10.22067/ifstrj.v15i4.72770

Zahra Karimivaloujaei, Mohammad Hossein Abaspour fard, Mohammad Hosein Aghkhani, Saeid Tarighi

Abstract Introduction: Packaging is one of the effective ways to increase the storage life and quality of the food products. Nowadays, most of the materials used in packaging are fossil origin and usually non-degradable and hardly dissoluble. Also biodegradable films, due to their fragility and poor resistant to gas exchange are in limited use. It is possible that by employing nanotechnology, some particles on nano scale may be added to these polymer composites to improve the mechanical properties and permeability of the biodegradable packing films. Silver nanoparticles and zinc oxide have been incorporated in polymers individually by researchers. The objective of this study is to compare the effect of incorporating the mixture of silver and zinc oxide nanoparticles with the case of adding them separately into poly vinyl alcohol matrix, on some relevant mechanical and physical properties of the outcome Nono-composite films.
 
Materials and methods: To make polymer films polyvinyl alcohol, solvent (deionized water) and glycerol (as softener) were used. Then, zinc oxide and silver nanoparticles at 3% by weight, were added to the polymer solution in two different ways, separately and in combination. To specify the pattern of nano-particles size distribution, transmission electron microscope (TEM) test was performed. To determine the characteristics of the films’ surface scanning electron microscope (SEM) was employed. To investigate the bondings between the components of nono-composite films, FTIR was employed.For identification of matrix structure and formation of nano-composite, the XRD was performed. To measure the infiltration of water vapor, the approved E96 ASTM method was used. Also, for measuring the color and transparency of films, the HunterLab test and for mechanical properties of the films, Instron Universal Testing Machine (H5 KS, England) were used (considering the ASTM standard for tensile tests - D88201). For statistical analysis and comparison of means, variance analysis and Dunkan test were performed, using SPSS software.
 
Results & discussion: SEM, XRD and FTIR tests showed that nanoparticles were distributed uniformly within the polymer matrix, and react well with the polymer chains. Besides, the effect of adding silver and zinc oxide nanoparticles on the relevant properties of the films was significant. By individual adding of these nanoparticles on polyvinyl alcohol matrix, the tensile strength and the elongation of films increased. On the other hand, their transparency and water vapor permeability decreased. The results also showed that the combined incorporation of silver and zinc oxide nanoparticles into the packing films can significantly affect their mechanical properties and permeability. Hence, due to the high prices of silver nanoparticles than zinc oxide nanoparticle, the combined incorporation of these two nano-particles is recommended, while maintaining the properties of the nano-composite films in a reasonable level. It can be implied that the combined use of silver and zinc oxide nanoparticles in the polymer provides a more affordable Nano-film with good enough quality. It may also reduce their mutual side effects.

Research Article

Physical and chemical properties of whipped cream containing Liquorice powder

Pages 419-431

https://doi.org/10.22067/ifstrj.v15i4.75272

Zahra Hoseinpour, Hojjat Karazhiyan

Abstract Introduction: Whipped cream is one of the cream products that is widely used in confectionary products and is bulked by whipping and incorporating air bubbles. Cream is converted to a foam system by aeration process. The continuous phase is liquid serum and the dispersed phase is air bubbles. Profit formation of a complex foam-emulsion structure of whipped cream to create a desirable texture is dependent on different factors such as whipping conditions, fat content, and presence of stabilizers. A whipped cream with appropriate quality should contain 30-40% milk fat, easily whippable, and produce good foam with high over run. It should also have a long shelf-life and maintain its stability during preservation. Liquorice is one of the oldest pharmaceutical plants, whose active ingredients are used in pharmacy, confectionary, and beverage industries. The most important active ingredient is glycyrrhizic acid which is 50 times sweeter than sucrose. Its root is also an overflowing source of saponin which has different physiochemical properties. Stable foam formation is a property of saponin index. Liquorice saponin can be used in industrial use especially in pharmaceutical, food, and cosmetics industries. The aim of current research is to evaluate physiochemical and rheological properties and textural attributes of whipped cream containing different levels of liquorice powder as an aerating and foaming agent.
 
Matrials and methods: Whipped cream was produced from cream with at least 70% fat content, low fat pasteurized milk with 1.5% fat content, milk protein concentrate with 70% protein content, vanilla, sucrose, and different levels of liquorice powder (2, 4, 6, and 8%). Whipping time, acidity, pH, over run, and syneresis of final products were evaluated. Rheological properties were studied at 40C and at shear rate 0-100 S-1. Textural attributes were evaluated using back extrusion with a cylindrical probe (38 mm diameter) and penetration rate 1 mm/s and penetration depth 30 mm.
 
Results and discussion: Whipping time increased with elevation of liquorice percentage in whipped cream formulation, which is due to presence of stabilizers which can both increase the viscosity of liquid phase and prevent foaming properties of milk proteins from protein-stabilizer interactions. The highest over run belonged to 4% treatment while the lowest magnitude was reported for 8% sample. Over run quantity is dependent on different factors such as mixture ingredients including fat content, solid materials, sweeteners, and presence of stabilizers. Due to presence of saponin in liquorice, it can be concluded that elevation of over run in samples containing liquorice up to 4% is probably because of foaming ability of saponins. From literature review, it has been reported that with the rise in gum concentration (gum in liquorice), over run decreases in the foam system. Generally, with further increase in viscosity of the liquid phase with the growth of gum concentration, air bubbles cannot be introduced to the system through aeration process. Hence, the descending trend in over run of samples containing 6 and 8% liquorice is probably due to higher viscosity of the whipped cream. Acidity content of samples also increased. Acidity increment in whipped cream samples with liquorice rise is probably due to the acidic nature of saponins in liquorice powder. PH was reduced significantly with an increase in liquorice amount in the formulation a growth in acidity. Saponins present in the extract can produce acidic properties to some extent. The highest extent of syneresis in different samples was reported for 6% while the lowest amount was for 2%. Syneresis in confectionary cream shows emulsion rupture and has a close relationship with product viscosity. So it can be expected that higher viscosity in whipped cream results in less syneresis in the final product. According to the results of the current research, syneresis value in 2% was lower compared to control sample, which is probably due to the increase in viscosity of the whipped cream. With elevation of liquorice, syneresis increased compared to the control sample. As indicated, liquorice root has gum and gums increase the viscosity of the final product, thereby reducing syneresis by absorbing water and incorporating it in the gelly network. Power law model was selected for predicting rheological properties of samples. The results suggested that flow index behavior was less than 1 in all samples indicating non-Newtonian, pesudoplastic behavior. Apparent viscosity versus shear rate showed shear thinning behavior, which indicated that the apparent viscosity diminished with increase in the shear rate. Gums have shear thinning behavior, so regarding the presence of gum in liquorice and augmented liquorice percentage, more deviation from Newtonian state was observed. Textural analysis indicated that hardness, adhesiveness, and adhesive force had an ascending trend with increase in liquorice percentage except for 4% sample. Totally, it can be concluded that a desirable product with higher over run and profit texture can be obtained using liquorice powder as a natural, native, local plant product in whipped cream formulation with pharmaceutical properties which can be potentially useful for the health of consumers.
 

Research Article

Proprietary diagnosis of aflatoxin G1 based on aptasensor colorimetry using gold nanoparticles Suspension

Pages 433-439

https://doi.org/10.22067/ifstrj.v15i4.70900

Arezoo Hashemnia, Vahid Hakimzadeh

Abstract Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields which, when they interact with electromagnetic resonance radiation, their radiant properties rises sharply. This process causes the absorption process of these nanoparticles to be several times stronger than the absorption process of the strongest adsorbent molecules and their scattered light is several times more intense than the organic materials fluorescence. These unique properties provide a high potential for these nanoparticles to be used in many applications such as biochemical sensors, biomedical imaging and medical treatments. Aptamers are single-stranded oligonucleotides, DNA, RNA or proprietary proteins that have the ability to attach specifically to their target. The basis for identifying the target by aptamers is the third structure formed by them. One of the important benefits of aptamers to antibodies is their smaller size, which makes them more easily and effectively penetrated. It also has neither toxicity nor immunogenicity unless in very low levels. Therefore, biosensors that use aptamers as biological identifiers are known as aptasensors. In this research, due to the high losses caused by aflatoxins to the crops and their toxicity, the rapid detection of these pesticides by aptasensor method was investigated.
 
Materials and methods: The test was carried out in a 96-well plate and for each concentration three replicates were considered. In each test, 100 μl of the nano gold solution, which was centrifuged twice at 12000 rpm and at room temperature, was thrown into 11 concentrations and three repetitions in the plate houses. Then adding 15 μlit of aptamer at a concentration of 5 μmol plus 10 μlit of distilled ultrapure water to the houses and incubate for 30 minutes at room temperature. After this time, 25 μlit of different concentrations of aflatoxin plus 15 μlit of 2 molar salt solutions and 35 μlit of distilled water were added to the houses and, after mixing (up and down) in the ELISA reader, absorbed it we read.
 
Results and discussions: At first, with adding the aptamer to Nano gold particles a complex between nanoparticles and aptamer is created. But in present of suitable aflatoxin, the complex of nanoparticle and aptamer is separated and a new complex between aflatoxin and nanoparticle is formed. Subsequently the color is changed to purple. This color change is visible to the eye, indicating that the Aptamer is suitable for Target. In this study, it was found that an aptamer with GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA sequence only affects aflatoxin G1 and other aflatoxins such as B1, B2, and G2 should be considered as another sequencer for Aptamer.

Research Article

The effect of some species of yeasts on reduction of aflatoxin B1 of Aspergillus flavus in simulated model of human stomach

Pages 441-452

https://doi.org/10.22067/ifstrj.v15i4.74793

Sahar Bahram vand, Seddiqe Mohammadi

Abstract Introduction: AFB1 is a highly carcinogenic secondary metabolite of some species of Aspergillus. Recently, use of microorganisms has been increased to reduce the absorption of mycotoxins in gastrointestinal tract. So, in this study the effect of the three yeasts Saccharomyces cerevisiae, Pichia fermentans, and Rhodotorula mucilaginosa on reduction of AFB1 in a simulated model of human stomach was investigated.
 
Materials and methods: At first, A. flavus was isolated and then were purified. Then, AFB1 was produced in PDB media and presence of AFB1 was determined by blue fluorescence radiation under UV light. Toxin was extracted using the method of solvation in chloroform and injected into HPLC and the final concentration was 49 ng/ml. The simulated stomach was contaminated with 0.1 ml samples of AFB1 of three concentrations: 0.25 ng/ml and 0.50 ng/ml from standard AFB1 and also 49 ng/ml from the A. flavus under study. Then the yeasts were added and the mixture was incubated. After sampling at 0 and 120 minutes, the samples were centrifuged. The supernatants were separated to determine the concentration of residual toxin by direct competitive ELISA method. The experiment was conducted in a completely randomized design with a factorial experiment. The three factors included yeast (four levels: three yeasts and non-yeast treatments), concentration (four levels: 0, 0.25, 0.50 and 0.49 ng/ml) and time (two levels: 0 and 120 min). The whole experiment was carried out 3 times.
 
Results & ddiscussion: The results showed that all three yeasts had the ability to reduce the toxin in the stomach compared to the control treatment (without yeast), but the effect of R.mucilaginosa was more significant than the other two. The lowest toxin concentration in supernatant was observed at 0.25 ng/ml. Over time, toxin concentration in supernatant decreased. The interaction of yeasts and toxin concentration showed that in comparison with the control, at each three concentrations, all three yeasts could reduce toxin concentration. The minimum toxin concentration in supernatant was obtained at 0.25 ng/ml in the presence of R.mucilaginosa. The results of interaction of yeast×time showed that after both 0 and 120 minutes, all three yeasts were able to reduce the toxin and the minimum toxin concentration was observed after 120 minutes for R.mucilaginosa. The results of interaction of time and toxin concentration in the model showed that at 0.25 ng/ml toxin concentration was at the lowest level after 120 minutes. The results of interaction of yeast×time×toxin concentration showed that the lowest toxin concentration was related to R.mucilaginosa after 120 minutes at 0.25 ng/ml. To conclude, the results of this study showed that all three yeasts had the ability to reduce AFB1 in the simulated model of human stomach, but R.mucilaginosa can be introduced as the most efficient isolate in biocontrol of AFB1.

Research Article

Investigation of mechanical, physical and antibacterial gelatin film incorporated by Turmeric (Curcuma longa) hydrosol

Pages 453-463

https://doi.org/10.22067/ifstrj.v15i4.74964

Zohreh Didar

Abstract Introduction: Nowadays, edible packaging founds great attention due to environmental issues related to synthetic packaging materials. Gelatin is one of the most commonly ingredients used in edible packaging formulation due to its good barrier properties against gases and UV irradiation. Addition of plant extracts or essential oils is one approach for confer antimicrobial activity to edible films. The aim of this study was to use different percentages (5-100%) of turmeric hydrosol in the formulation of edible gelatin films and assessing the various properties of the resulted film.
 
Materials and methods: Extraction of turmeric hydrosol was done by Clevenger apparatus. Separation of the essential oil from hydrosol was done by a separating funnel. For preparation of gelatin films, 4g gelatin was dissolved in 100ml distilled water, and glycerol as plasticizer was added at ratio of 25w/w gelatin. In gelatin films included turmeric hydrosol, substitution of turmeric hydrosol instead of distilled water in the ratio of 5-100% was performed. Then, the mixture was poured in plexiglass plates (80×120 mm) and dried at 22ºC, 50% RH for 48h.Texture analysis was carried out using the texture analyzer TA-XT plus. The water vapor permeability (WVP) was measured using gravimetrically method. Light transmission was determined by spectrophotometer jenway 6305 at 200-800 nm wavelength. Morphological assessment was performed by scanning electron microscope (phenom proX). For Fourier-transform infrared spectroscopy analysis, Perkin-Elmer (Spectroma2 model) at 4000-4500 cm-1 frequency, used. Antimicrobial test was done by measurement inhibitory zone (mm) of edible films against Staphylococcus aureus (PTCC 1112), Staphylococcus saprophyticus (PTCC 1440) and Staphylococcus epidermium (PTCC 1435).
The studied bacteria (Staphylococcus aureus, Staphylococcus saprophyticus and Staphylococcus epidermium) were purchased from the Iranian Scientific and Industrial Research Center and transferred to the suitable medium in sterile condition and incubated at 37°C for 32 hours. Microbial cells were harvested by centrifugation at 4000 rpm. For the estimation of microbial population, McFarland turbidity method was applied. First, the results from comparing turbidity showed the population of microorganisms was equal to 0/5 McFarland solution (approximately 1/5×108 CFU/ml), then for reaching to the desired microbial population (1/5 × 106 CFU/ml), dilution with physiological saline was done.  Agar disc diffusion method was used for assessing the antimicrobial effect of the gelatin films.  
Gelatin films were cut into a 10mm diameter in aseptic condition using a circular knife and then placed on agar plates inoculated with 100µL of tested bacteria (with approximately 106 CFU/mL).  The plates were then incubated (37ºC, 24h). The diameter of the inhibition zone was precisely measured using a digital micrometer (Guanglu model 701-211). Each experiment was performed triplicate.
 
Results and discussion:  The results of this study showed that the use of turmeric hydrosol causes significant difference on mechanical and physical properties of related gelatin films (p≤0.01). The stress tension was increased by adding hydrosol to the edible film formulation, but the elongation percentage of the edible film decreased. The highest the stress tension was observed in sample containing 100% hydrosol (33.3 Mpa) but the lowest elongation percentage also was belong to this sample (96%). Addition of hydrosol to film formulation cause increasing of UV-radiation barrier property and reducing the transparency of the film. FTIR analysis of gelatin films included turmeric hydrosol, exhibited the existence of aromatic bonds according to appearing peak at 680cm-1. 
Structural studies by SEM method, showed uniformity in the structure of different gelatin films and hydrosol addition cause minor changes in the structure of films. The water vapor permeability was influenced by the edible film formulation and by adding different percentages of turmeric hydrosol, the permeability to water vapor, decreased (p≤0.01).Thickness was also affected by gelatin formulation and hydrosol caused reduction the thickness. Antimicrobial assessments showed that the addition of turmeric hydrosol cause inhibitory effects against studied staphylococcus strains. Staphylococcus aureus and Staphylococcus saprophyticus showed the highest susceptibility to hydrosol included films (­inhibition zone equal to 37 mm for gelatin film included 100% turmeric hydrosol).

Research Article

Modeling of hardness and drying kinetics of "quince" fruit drying in an infrared convection dryer using the artificial neural network

Pages 465-475

https://doi.org/10.22067/ifstrj.v15i4.76323

Amir Gitiban, Narmela Asefi

Abstract Introduction: Dried fruits are one of the most important non-oil exports and the efforts should be made to grow the economy of the country by increasing their exports to world markets. Meanwhile, quince juice contains various minerals including iron, phosphorus, calcium, potassium and rich in vitamins such as vitamins A, C and B vitamins. Drying of food is one of the ways to keep its quality and increase its shelflife. During this process, the removal of moisture through the simultaneous transfer of heat and mass occurs. By transferring heat from the environment to the foodstuff, the heat energy evaporates the surface moisture. The drying process has a great impact on the product. In recent years, new and innovative techniques have been considered that increase the drying rate and maintain the quality of the product and infrared drying is one of these novel techniques.. Infrared systems are emitting electromagnetic waves with a wavelength of 700 nm to 1 mm. The advantage of using infrared is to minimize waste and prevent product quality loss due to reduced drying time can be mentioned. The need to predict product quality in each process makes it necesary to model and discover the relationship between factors that can affect the final quality of the product. Artificial neural networks have been considered as a meta-innovative algorithm for modeling and prediction, which can be favored by the ability of these networks to model and predict processes The complexity and discovery of non-random fluctuations in data and the ability to discover the interactions between variables, economical savings in the use and disconnection of classical model abusive constraints (Togrul et al., 2004), the ability to reduce The effect of non-effective variables on the model by setting internal parameters is the ability to predict the desired parameter variations with minimum parameters (Bowers et al., 2000).
 
Materials and methods: In this research, quince fruit (Variety of Isfahan) was purchased as the premium product of Isfahan Gardens and was kept at 0°C in the cold room prior to further experiments. The fruits were removed from the refrigerator one hour before processing and exposed to ambient temperature. After washing, surface moisture was removed by moisture absorbent paper and turned into slices with a constant thickness of 4 mm. The specimens were subjected to pre-treatment with an osmotic solution (vacuum for 70 minutes at a temperature of 40 ° C for 5 hours). For drying the samples, an infrared convective dryer with three voltages (800.400 and 1200 watts) and a constant speed of 0.5 m / s was used. In this way, the samples were placed under infrared lamps on a plate made from a grid and the weight of the samples was measured in a scale of 10 minutes by means of a scale and recorded on the computer. In order to achieve stable conditions in the system, the dryer was switched on 30 minutes before the process. The distance between the samples and the infrared lamp was fixed in all treatments at 16 cm. The drying process continued to reach a moisture content of 0.22 basis. To perform a puncture tests, quince slices were used in a Brookfield-based American LFRA-4500 tissue analysis device. In order to model these parameters in the drying process, the results of examining the quality of the samples, including the firmness of the tissue as well as the drying time, were used as network outputs. The power, concentration and pressure parameters were considered as network inputs. In this research, a multilayer perceptron network (MLP) was used. Due to its simplicity and high precision, this model has a great application in modeling the drying of agricultural products. Many functions in transmitting numbers from the previous layer to the next layer may be used (Tripathy et al., 2008).
 
Result & discussion: The results indicated that the stiffness of the tissue is reduced in vacuum conditions with increased power. So, the least amount of stiffness was related to osmotic sample dried at 1200 watts. By increasing the infrared power, the stiffness of the tissue decreases, the reason for this is probably the volume increase phenomenon that occurs during the rapid evaporation of moisture through infrared rays from inside the tissue. The results showed that at the start of the drying process, due to the high moisture content of the product, the moisture loss rate is high. Gradually, with the advent of time and reduced initial moisture content, the rate of moisture reduction naturally decreases. At lower power, the drying time is longer and with increasing power, the drying time decreases due to the increase of the thermal gradient inside the product and consequently the increase in the rate of evaporation of the moisture content of the product. The results of this study showed that the neural artificial network, as a powerful tool, can estimate the stiffness parameters of the tissue and the drying time with high precision. The most suitable neural network structure to predict these parameters with a 3-7-2 topology along with logarithmic activation functions with a total explanation coefficient above 0.9923 represent the best results. Also, by increasing the drying capacity and using osmotic dehydration, the drying time and the stiffness of the tissue samples is decreased.

Research Article

Evaluation of physicochemical properties of pectin extracted from eggplant waste using ultrasound technique

Pages 477-484

https://doi.org/10.22067/ifstrj.v15i4.79504

Mohammad Noshad, Mohammad Amin Mehrnia, Nasim Dehghan

Abstract Introduction: Pectin is a type of water-soluble hetero-polysaccharide that is present in the primary cell wall of plant and is used as a jellying, thickening and stabilizing agent in various food products. The degree of esterification is the most important determinant of the use of pectin in the food products, according to pectin is divided into two groups: high-esterification pectin (50% degree of esterification) and pectin with degree low esterification (degree of esterification less than 50 %(. Considering the high use of pectin in the food products, researchers are now looking for new sources of pectin extraction, among which the use of food waste has been considered high, because the waste of food factories is a major challenge for food manufacturers. Eggplant (Solanum melongena) belongs to the Solanaceae family, which is used extensively in the world. The plan species is believed to have originated in India, where it continues to grow in southern and eastern Asia.  The skin and warhead of this product, which is discarded as waste, can be used as a valuable source for pectin extraction. The most commonly used methods for pectin extracting are the use of hot water, along with acids, which is a time-consuming process and the waste discard of this method is environmentally problematic. Therefore, the use of new methods such as ultrasound has been considered by researcher to minimize the limitations of the traditional method of pectin extracting. The purpose of this study was to extract pectin from eggplant waste using ultrasound and evaluate its physicochemical properties.
 
Material and methods: The waste of eggplant from restaurant of agricultural sciences and natural resources university of Khuzestan were prepared. The waste was dried in an oven at 60 ºC to reach constant weight. The dried waste was powdered using a grinder and passed through the sieve. The ultrasound was used to extract pectin from eggplant waste (skin and warhead). For this purpose, the effect of ultrasound time (40-80 min) and dry matter /solvent ratio (1:10 – 1:30 g/ml) on extraction efficiency degree of esterification of extracted pectin were investigated. The FTIR (wavelengths scanned 4000-400 cm−1) and rheological behavior were studied to evaluate the performance characteristics of the extracted pectin. Analysis of variance (ANOVA) procedure followed by Duncan’s test using SPSS 16 (SPSS Inc., Chicago, IL, USA) software was applied to determine the significant difference (P < 0.05) between treatment means.
 
Result & discussion: Based on results, increasing the extraction time had a significant effect (P<0.05) on the pectin extraction, so that the increase in extraction time from 40 to 60 min increased the extraction efficiency from 14.05 ±0.21 to 29.35±0.21 (%), which is probably due to the fact that the cavitation causes the cell wall to break down and more solvent penetrates the cell matrix, which results in increased extraction of pectin. The highest efficiency of pectin was obtained in the dry matter /solvent ratio (1:10 g/ml) and 60 min. The highest degree of esterification (84.18 ± 0.1 %) was obtained in the dry matter /solvent ratio (1:20 g/ml) and 60 min. Also, the degree of esterification of the obtained pectin varied from 67.69 ± 0.02 to 84.14 ± 0.1 %), which indicated the high quality of pectin was extracted. Due to the fact that the steric bonds are more unstable than acidic hydrolysis in comparison with glycosidic bonds, the higher degree of esterification indicates less damage to the pectin structure during the extraction process. FTIR showed all of the pectin's specific spectra and abundance of methoxy groups in extracted pectin. The FT-IR spectra show the characteristic absorption of -CH at the ranges of 3000-2800 cm-1 and at 1421 cm-1, while the wide band at 3406 cm–1 was assigned to the -OH stretching vibration. The wide band at the ranges of 1700-1600 cm-1 can be due to the stretching vibrations of the C=O bonds in the backbone of crude polysaccharide because of presence of uronic acid. Existence of a peak at 1200-900 cm-1 indicates that pectin contained multiple vibrations of glycosidic (C–O-C) and pyranoid (C=O) linkages due to the characteristic of the pyranose form of glucosyl residues. The apparent viscosity of the extracted pectin solution decreased with increasing shear rate (0.5 to 10 s-1) while in the higher shear rate (10 to 100 s-1), the apparent viscosity of the pectin solution remained almost constant. This process shows that the produced pectin solution at low shear rate exhibits pseudo plastic behavior, while at highest shear rate exhibits Newtonian behavior. These results indicated that eggplant waste could be used as a good source of high-performance pectin.

Research Article

The influence of pulsed electric field and microwave pre-treatments on some characteristics of oil and meal obtained from Niger seed

Pages 485-496

https://doi.org/10.22067/ifstrj.v15i4.74361

Nazanin Maryam Mohseni, Habibollah Mirzaee, Masoumeh Moghimi

Abstract Introduction: Niger seed with scientific name of Guizotia abyssinica Cass from Asteraceae family is a dicotyledonous and one year plant that is one of the main and most important oil sources in Ethiopia and India. In different researches the amount of extracted oil from the seed of this plant has been mentioned about 37 to 50 percent. The composition of fatty acid in this plant is similar to safflower and sunflower seed oil (of course with high percentage of Linoleic acid that may reach more than 85 percent). Generally, the mechanical press is one of the most popular methods for extracting oil from vegetable oil seeds all over the world. Increase in temperature will lead to more and faster extraction of oil from seeds and will increase the extraction efficiency. Microwave, is the non-ionized electromagnetic wave with frequency between 300 MHz to 300 GHz and are placed between the radio and infrared waves in the electromagnetic spectrum, consumers’ increasing demand for higher quality products and with minimized waste of nutrients in comparison with conventional thermal methods, caused an increase in use of non-thermal methods such as pulsed electric field methods. In current research it is tried to study the influence of pulsed electric fields and microwave pre-treatments on some characteristics of oil and meals obtained from Niger seed.
 
Materials and methods: To perform this research, the Niger seeds (contain 40% oil) was prepared from local market of Fars Province (Iran). Then the external materials such as weed seeds, sand and stones were separated and removed manually  and the seeds were treated with microwave pre-treatment with power of 900W and different procedure times (100 and 200 seconds), and pulsed electric field with two levels of electric field intensities of (250 and 500 kV/cm with 30 pulses). After performing these treatments, the seeds oil was extracted with screw press at the speed of 34 rpm then various experiments, such as the efficiency amount of oil extraction, refractive index, total phenolic compounds, oxidative stability, protein and ash of meals, were performed on the oil in a complete random model with three repetitions.
 
Results and discussions: The comparing group mean test with Duncan’s method indicated that applying pulsed electric fields and microwave pre-treatments in lower times and intensities caused an increase in extraction efficiency. But with increase in the microwave time and also increase in the intensity of pulsed electric field, the efficiency of oil extraction was decreased in such a manner that when a pulsed electric field with intensity of 500 kV/m was used, the oil extraction had the lowest extraction efficiency. The increase of oil extraction efficiency using microwave can be related to more fracture or disintegration of cells which contain oil during treating with microwave. The reason for increase in the efficiency of oil extraction using the pulsed electric fields can be attributed to the electrical decomposition of cells and more permeability of them. A decrease in the oil extraction efficiency with excessive increase in the microwave time and intensity of electric field is probably attributed to more degradation of seeds internal structure and closure of oil outlet duct. Analysis of data obtained from oils refractive index indicated that the pre-treatment type didn’t have any significant influence on the oils refractive index (P>0.05) and the amount of refractive index was 1.478 for all of the measured samples (figure 2). Applying various pre-treatments, caused an increase in the amount of total phenol and oxidative stability of oils in the manner that the maximum amount of total phenol and oxidative stability was obtained from pulsed electric field pre-treatment with the intensity of  500 kV/m.  The amount of tocopherol and antioxidant compounds can be the reason for this observation because of applying these pre-treatments. Variance analysis of data obtained from performing tests and experiments indicated that the influence of pre-treatment type on the amount of protein and meals ash was completely significant (P<0.01). Comparison of the means in data obtained from experiments showed that the maximum and minimum amount of protein and meals ash in the treated sample was obtained with 100 seconds microwave and the pulsed electric fields with 500 kV/m intensity, respectively, in other words, applying various treatments (in low times and electric field intensities of microwave and pulsed electric fields) in oil extraction led to an increase in the amount of protein and ash in comparison with non-treated sample and the reason of this fact can be attributed to the more extraction of oil from seeds and consequently an increase in the % protein and ash remained in the meals. Finally, the results of this research indicated that applying microwave (for 100 seconds) and pulsed electric field (with electric field intensity of 250 kV/m) can be very useful in extracting oil from Niger seed because of increase in the extraction efficiency and also increase of useful compounds in oil.

Research Article

Evaluation of chemical parameters for authenticity of commercial lime juice

Pages 497-506

https://doi.org/10.22067/ifstrj.v15i4.64465

Zahra Alaei Roozbahani

Abstract Introduction: Citrus fruits are rich sources of dietary fibre and bioactive compounds, including vitamin C, phenolics and flavonoids, with potential health-promoting properties. Nowadays citrus production is the main activity of the producers of fruit trees in the world (104 million tons, 7.1 _ 106 ha) and the countries with higher production are Brazil, China, India, USA, Mexico and Spain, as well as many other tropical and subtropical regions in the world. The authenticity and safety of food is of great importance to both producers and consumers. Foods must be produced in accordance with legal requirements. Adulterated foods affect the consumer negatively in terms of nutrition, health and economics; they cause an imbalance in the domestic market and furthermore, they cause harm to regional economics. The expensive production and consumption of adulterated foods is widespread. Profit is gained with the adulterate, the consumer is deceived as well. The adulteration of citrus juice is a significant worldwide problem. Fruit juices may have undergone dilution with water (Boland, 1988), addition of sugar (Brause et al., 1987), acidification and aroma intensification (Benk, 1976; Richard, 1978). Addition of foreign substances to the juices or addition of juices from other fruits are the other fraudulent practices (Iranzo, 1977). The AIJN, Association of the Industry of Juices and Nectars of the European Union (EU), has established reference guidelines for several fruit juices, including lime. The referred values in these guidelines are based on pure, authentic fruit juices obtained from the edible part of mature and sound fruits of different varieties and geographical origins obtained by mechanical processes.  The characterisation of Iranian lime juices by measuring their physicochemical quality parameters is of special interest to contrast them with the actual international standards: Codex Alimentarius and AIJN Code of practices. It is also very useful to detect adulteration or dilution of juices and to distinguish these high-quality juices. The aim of this study was to contribute to the knowledge of commercial lime juice and pure lime juice characteristics, the obtained parameters will be compared with the international standards.
 
Material and methods: Ten samples of lime juice were obtained from different fruit juice factories in 2016. Three samples were prepared in laboratory by pressing fresh fruits. All samples were analyzed in duplicate .A panel of different analytical techniques established by IFU (International Federation of Fruit Juice Producers, Paris, France), codex and ISIRI were used for determination of physicochemical parameters, organic and mineral contents in lime juices.
 
Results and discussion :Parameters that characterize the absolute quality requirements:According to these results, relative density of the all lime juice samples varied between 1.030 and 1.040.in all lime juice samples tested, relative density was higher  than 1.0298, the maximum prescribed value by AIJN (2016). Titratable acidity of juices typically varied between 50 and 90 g/L calculated as anhydrous citric acid. In all lime juice samples tested, titratable acidity was found to be acceptable. Ethanol and volatile acids are not present in sound fruits; they are indicators of spoilage by epiphytic microorganisms such as yeasts, acetic acid bacteria (AAB) and lactic acid bacteria (LAB). The small amounts detected can be taken as an indication of the processing of good quality and absence of fermentation processes in juice. The amounts detected in juices from all samples was lower than the maximum (universal) limit of 0.4 g/L. Heavy metal elements contained in fertilizer and contaminated soils are transmitted into fruits and other farm produces. Heavy metal contents detected in all samples by atomic absorption spectrometry (AAS) were acceptable. 5-Hydroxymetylfurfural (5-HMF) is practically not present in fresh fruit juice, but it is naturally generated during heating or storage processes in the Maillard reaction as well as sugar caramelization and degradation. Therefore, 5-HMF can be used as an indicator for excess heat treatment and deterioration. In all lime juice samples tested, concentration of 5-HMF was much lower than 20 mg/L, the maximum prescribed value by AIJN. Synthetic color and preservative material such as sorbic and benzoic acids were also carry out. Values were not obtained for these parameters. Criteria relevant to the evaluation of identity and authenticity: Analysis of  proteins, formol index, calcium, magnesium, sodium, potassium, phosphorus and sucrose have indicated ash, mineral elements and protein and formol index to be useful parameters for detection of adulteration. Ash and phosphorus content are fairly independent of regional variation and soil and are a fair criterion of added water in berry and fruit juices. The ash that represents the total mineral content of lime juice was between 2.84 and 3.85 g/L. The concentration of various elements in the tested samples were, in decreasing order, potassium (10-1350 mg/L) > sodium (63-907mg/L) > calcium (34–172 mg/L) >phosphorous (0-123 mg/L)>magnesium (10-75 mg/L).Potassium typically is the main mineral in lime. The finding of 1350 mg/L is consistent with this knowledge. Also 9 commercial samples did not reach the limits proposed by AIJN for more than one of these elements. The formol number, or formol titration, is merely an index which reflects the amount of free amino acid. It varied between 18 and 30 mL NaOH 0.1 N/100 mL. A chemical matrix method which allows identification of several compounds such as L-malic acid, chlorogenic acid and the fructose/glucose ratio, sucrose, fructose ,glucose can detect adulteration in apple and orange juices such as dilution with water, and addition of sugar, high fructose corn syrup, beet sugar and spent process water. Glucose, fructose and sucrose were detected and quantified in all juices tested. The presence of sucrose, glucose and fructose in lime juices varied between 0.0 - 4.6 g/L,1.48-12.7 and 0-9.8 respectively. 4 commercial samples did not reach the limits proposed by AIJN for these sugars.

Research Article

Comparison of antifungal effects of nigella sativa oil and extract with imazalil on two apple cultivars in cold storage

Pages 507-516

https://doi.org/10.22067/ifstrj.v15i2.77650

Soudabeh Einafshar

Abstract Introduction: Apple and its products play a major role in the Iranian agricultural economy. Apple fruit, after grapes, is the most important product of the country. Iran is ranked fourth in the global production of apple. After harvesting, to maintain the quality of apples, the cold stores are used. Molds like penicillium expansum causes significant damage to the quality and the quantity of apples and fungicides such as imazalil are used to control them. These fungicides usually decompose in nature slowly, and the residue of them, compromise the health of consumers and the environment. Scientists try developing new antifungal environment friendly materials.  Nigella Sativa oil and extract contain compounds such as Caron, Alfa-pinene, Sopinen, Beta-pinene and P-cimen. Alpha-pinene is a disinfectant material. Antimicrobial and antioxidant properties of Nigella Sativa have been reported in several studies. In this study, the possibility of replacing chemical fungicides such as Imazalil with Nigella Sativa oil and extract for extending the storage life of two apple varieties was investigated.
 
Materials and methods: The preservative effects of Nigella Sativa oil and extracts as an antimicrobial agent was compared with Imazalil fungicide for two cultivars of apples, Red and Golden Delicious. Nigella Sativa oil and extract were extracted by solvent extraction and they were sprayed at two concentrations (0.1 and 0.2%) on Red and Golden Delicious apple cultivars. The sprayed apples and the controls (samples containing imazalil without any additives) were kept in a cold store at 0°C for 6 months. During 6 months, total microbial count, mold and yeast, tissue hardness, brix, acidity, sensory, percentage of waste, moisture and vitamin C were tested each month.
 
Results and discussion: The results showed that Golden delicious variety with 8.16×103 had better bacterial properties, Brix (17.5), Moisture (80.07%) and Vitamin C (2.02 mg/100g) than that of Red Delicious. However, the texture of the Red Delicious variety (3.01N) showed more hardness than Red Delicious, less waste (3.63%) and higher overall acceptance (3.72). The effects of anti-microbial agents on the texture and acidity of apple cultivars were not significant, but it was significant on vitamin C (P<0.05). During storage for six months, all samples experienced a decrease in quality. In addition, there were increases in the total count of microbes (from 2.11×103 at first month to 15.33×103 at sixth month, mold and yeast (from 111 at first month to 6.25×103 at sixth month, and a significant decrease in other qualitative parameters. The effect of anti-microbial agents used in this research on mold and yeast was higher than that of total microbial count. Anti-microbial agents, especially Nigella Sativa oil and extract, had much lower mold and yeast content during the six months, than the control. The qualitative characteristics of the apple were also maintained. Therefore, Nigella sativa oil and extract are introduced as alternative to Imazalil that can prevent the microbial decay of apple.

Research Article

Investigation of physical and mechanical properties of edible film based on starch and oleic acid: application of coating on Greengage

Pages 517-527

https://doi.org/10.22067/ifstrj.v15i4.65266

Masoud Taghizadeh, Asma Eghbal

Abstract Introduction: One of the methods for increasing shelf life of food is the use of edible coatings, since films and coatings have an important role in the enhance of shelf life and food product’s marketing. Various edible films are nowadays used for food packaging. Using of these biodegradable compounds is a new method of replacing polymeric materials and of increasing shelf life of food. Film and coating can control the diffusion of water, oxygen and carbon dioxide. Edible coatings also have the ability to enhance color, acid, sugar and taste during storage. Starch as a natural polymer be a lot in the nature and has a low cost and due to its structure containing amylose and amylopectin it is a suitable option for its use as film and edible coating because starch is barrier for oxygen, semi-permeable to CO2, and has good mechanical properties, therefore suitable for packaging films and edible coatings. However, due to the hydrophilic properties of starch, the starch based films are permeable to moisture and water vapor. One of the ways to reduce water vapor permeability for films and edible coatings is to use hydrophobic compounds such as oleic acid that formed in two layers. There is starch in the lower part of layer. Hydrophobic compound place in the upper layer and it is the barrier for water vapor. The main purpose of this research was to produce edible films based on starch and oleic acid and to investigate their characteristics (thickness, solubility, water vapor permeability, and tensile strength). One of the suitable treatments was then selected and tested at three concentrations as a film coating for greengage, and cases of pH drop and loss of weight, color, and hardness of the samples were recorded for four weeks.
 
Material and methods: First, the film of starch and oleic acid were prepared and then the edible film characteristics such as thickness, solubility, water vapor permeability and tensile strength were measured. After evaluating the film parameters, the optimal amount of oleic acid was selected, then the starch and oleic acid solution of 8, 10, 12 g / l were prepared based on film formulation including starch, glycerol, oleic acid and tween 80. Then the characteristics of Greengage such as weight loss, pH, color and rigidity were measured.
 
Result & discussion: The addition of oleic acid resulted increases in thickness of the edible films because of the increase in the material during solvent drying and variation in the relative humidity of the environment during drying of the material.
Solubility: By increasing the amount of oleic acid, the amount of solubility decreased, which could be due to the change in the polarity of the film compounds, which increases the hydrophobicity of the film by increasing the oleic acid that is non-polar, and keep the polar parts away from water. Oleic acid, due to good hydrophilic properties, significantly reduces the vapor flow rate. According to the results, the lowest water vapor permeability is for 10% of oleic acid in the film. According to the results, the amount of tensile strength decreased with increasing oleic acid content. On the other hand, elongation has increased with the increase of oleic acid, and this again decreased in the film with 15% oleic acid. Oleic acid is a short-chain fatty acid, so it can be located between the amylose and amylopectin strands as a plasticizer and because of this, the amount of hydrogen cross link in the film has decreased and its resistance has decreased. Subsequently tensile stress of film increased due to the good and proper distribution of oleic acid in the film. But at the level of 15%, this amount of oleic acid was high, increasing the gap between the amylose and amylopectin strands, followed by weakened films, and both the tensile strength and long elongation were reduced. Regarding the parameters obtained in the film production (mechanical strength and transparency and water vapor permeability) the film formulation with 10% oleic acid was selected and the solutions with total solid of 8%, 10% and 12% for Greengage coating are selected. It is observed that weight loss for coated samples is less than the control sample. These results confirm the starch barrier against the passage of oxygen and carbon dioxide. In all treatments pH has increased over time. The increase in pH in the control sample is than the coated samples because of different respiration rates. Coated sample is a suitable gass barrier followed by reduce the amount of respiration rate, resulting in a slower rate of pH change. In the third and fourth weeks, changes were significant, and in the control samples, the amount of light was higher and the green’s index in them decreased. Color changes in fruits can take place due to loss of moisture and chemical and enzymes reactions. Proteolytic enzymes such as polyphenol oxidase can destroy phenolic compounds that affect color. According to the results, the highest weight loss and moisture loss associated with the control sample showed the highest rigidity over time, which significantly reduced these changes with coating the sample. It seems that the concentration of 10 and 12% of oxidized starch and oleic acid emulsion can be used for proper coating with the least loss of weight and color. Due to the fact that the oxidized starch is very transparent and has a low viscosity, its appearance is not negatively affected and can be used in food coatings.