نوع مقاله : مقاله پژوهشی
نویسندگان
1 گروه علوم و صنایع غذایی، دانشکده صنایع غذایی بهار، دانشگاه بوعلی سینا، همدان، ایران.
2 گروه زیست شناسی، دانشکده علوم، دانشگاه بوعلی سینا، همدان، ایران.
کلیدواژهها
عنوان مقاله English
نویسندگان English
Introduction: Nowadays, More people are interested in consuming organic products. Many of the organic foods and dairy products are produced by rural people and nomads in Iran. Some people are concerned about using of the contaminated organic foods with pathogenic microorganisms, because some of these organic foods are produced under poor hygienic conditions. On the other hand, many native strains of probiotic bacteria especially lactic acid bacteria can be found in these organic foods. In this study, the microbial community and sanitary quality of ewe’s drinking yogurt produced by Somar region nomads, by using culture dependent molecular method and next-generation sequencing (NGS), as a new tool for the culture independent molecular characterization of bacteria, were assessed.
Materials and methods: A total of three Ewe's drinking yogurt samples were collected from the nomads of Somar region in Iran under sterile conditions. For phenotypic identification of lactic acid bacteria, a volume of 0.1 milliliters of appropriate dilutions was cultured on MRS agar and M17 agar media. The plates were incubated at 37oC under anaerobic condition with Anaerocult® A for 48 hours. Typical LAB characteristics colonies were purified by streaking method on MRS agar and M17 agar. The catalase negative and Gram positive isolates were selected as presumptive lactic acid bacteria for phenotypic identification to the genus level. These isolated bacteria were tested for growth at 100C and 450C in MRS and M17 broth, gas production from glucose, growth in the presence of 6.5% and 18% of NaCl, growth at pH 4.4 and pH 9.6 and arginine hydrolysis. Isolates were identified by amplification of the 16S ribosomal RNA gene by Polymerase Chain Reaction and ribosomal DNA sequencing as a culture dependent molecular method. After DNA extraction of isolates, PCR was performed using prokaryotic 16S rDNA universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3). In the next step, the culture-independent molecular method based on next-generation sequencing of 16S ribosomal RNA gene amplicons was applied. The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locus‐specific sequences were: Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐ [locus- specific sequence] Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed. The fastq files from the next generation sequencing were analyzed with BaseSpace (cloud‐based software, MSR: Metagenomics, version: 2.4.60.8). This metagenomics analysis classified organisms from V3 and V4 amplicon using a database of 16S rRNA data and performed a taxonomic classification using the Greengenes database showing species level classification in a graphical format (http://greengenes.lbl.gov/). The analysis output was a classification of reads at several taxonomic levels: kingdom, phylum, class, order, family, genus, and species. The analysis results included tables, cluster pie charts, phylogenetic trees and bar charts. The average and error bars of the relative abundance (%) of bacterial species from ewe’s milk and yogurt were calculated using Microsoft Excel 2010 software.
Results & Discussion: A total of 40 bacteria as lactic acid bacteria were isolated from ewe’s drinking yogurt. Among isolated bacteria, two different genus of lactic acid bacteria were phenotypically characterized as 88% Lactobacillus, 3.5% Pediococcus and 8.5% Non-lactic acid bacteria. Isolates were identified by ribosomal DNA sequencing as Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus.
The microbial community from ewe’s drinking yogurt were identified on the basis of Next-generation sequencing (NGS) at genus level as 94.08% Lactobacillus, 1.07% Pediococcus, 0.33% Streptococcus, 0.20% Enterococcus, 0.11% Candidatus Blochmannia, 0.11% Alkalibacillus, 0.06% Cohnella and 3.02% unclassified. At species level 24.82% Lactobacillus equicursoris, 51.81% Lactobacillus delbrueckii, 3.61% Lactobacillus apis, 2.79% Lactobacillus ultunensis, 0.86% Lactobacillus taiwanensis, 0.85% Lactobacillus gigeriorum, 0.42% Pediococcus argentinicus and 13.64% unclassified were identified. Findings of this study have provided fundamental knowledge on sanitary quality and microbial composition of drinking yogurt produced by Somar nomads. Both phenotypic and molecular identification methods showed Pediococcus and Lactobacillus genus as the dominant genera in these samples. Molecular identification results showed Lactobacillus delbrueckii as the dominant species. Four species, Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus were identified by both cultivation-dependent and cultivation-independent (NGS) methods. Rather, culture-dependent and culture-independent methods were found to be complementary in describing the microbial community of the ewe’s drinking yogurt produced by Somar nomads. The next-generation sequencing was found to be more accurate method in detecting the microbial diversity of drinking yogurt. The results showed poor hygienic quality of ewe’s drinking yogurt from Somar nomads, but there were no pathogenic bacteria in this product.
کلیدواژهها English
| تعداد مشاهده مقاله | 1,875 |
| تعداد دریافت فایل اصل مقاله | 1,199 |