با همکاری انجمن علوم و صنایع غذایی ایران

مقایسه تنوع میکروبی دوغ گوسفندی عشایر ناحیه سومار به کمک روش های نسل جدید توالی‌یابی و مولکولی وابسته به کشت

نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه علوم و صنایع غذایی، دانشکده صنایع غذایی بهار، دانشگاه بوعلی سینا، همدان، ایران.

2 گروه زیست شناسی، دانشکده علوم، دانشگاه بوعلی سینا، همدان، ایران.

چکیده
برخی مردم نگران مصرف مواد غذایی ارگانیکی هستند که احتمالا توسط ریزسازواره‌های بیماری‌زا آلوده شده‌اند، زیرا برخی از این مواد غذایی تحت شرایط بهداشتی ضعیف تولید می‌شوند. هدف از این مطالعه ارزیابی کیفیت بهداشتی دوغ گوسفندی از عشایر سومار و شناسایی کل جامعه میکروبی آن به‌خصوص باکتری‌های اسید لاکتیک می‌باشد. مجموع 40 باکتری اسید لاکتیک از 3 نمونه دوغ گوسفندی جدا گردید. این جدایه‌ها براساس روش مولکولی وابسته به کشت، توسط تکثیر ژن 16S rRNA با پرایمرهای یونیورسال27F و 1492R و توالی‌یابی، به‌صورت Lactobacillus apis 20% Lactobacillus ultunensi,10% Pediococcus argentinicus, 10% و Lactobacillus delbrueckii 40% شناسایی گردیدند. این شناسایی توسط روش مولکولی مستقل از کشت براساس نسل جدید توالی یابی آمپلیکون‌های ژن 16S ribosomal RNA کامل شد. نواحی V3 و V4 از ژن 16S rRNA تکثیر شد و توسط پلتفرم Illumina MiSeq توالی‌یابی گردید. این داده‌ها با نرم‌افزار BaseSpace و بانک اطلاعاتی greengenes آنالیز گردید. جامعه میکروبی دوغ گوسفندی برپایه نسل جدید توالی‌یابی در سطح جنس به‌صورت 08/94% Lactobacillus، 07/1% Pediococcus، 33/0% Streptococcus، 20/0% Enterococcus، 11/0% Candidatus Blochmannia، 11/0% Alkalibacillus، 06/0% Cohnella و 02/3% باکتری غیرقابل طبقه‌بندی شناسایی شدند. در سطح گونه به‌صورت 82/24% Lactobacillus equicursoris، 81/51% Lactobacillus delbrueckii، 61/3% Lactobacillus apis، 79/2% Lactobacillus ultunensis، 86/0% Lactobacillus taiwanensis، 85/0% Lactobacillus gigeriorum، 42/0% Pediococcus argentinicus و 64/13% باکتری غیرقابل طبقه‌بندی شناسایی شدند. روش نسل جدید توالی‌یابی در شناسایی تنوع میکروبی دوغ صحیح‌تر و بهتر شناخته شد. نتایج نشان داد دوغ گوسفندی عشایر سومار از کیفیت ضعیف بهداشتی برخوردار است اما هیچ باکتری بیماری‌زایی در این محصول شناسایی نگردید.

کلیدواژه‌ها


عنوان مقاله English

Comparison of microbial diversity of ewe's drinking yogurt from somar region nomads using Next-Generation Sequencing and culture dependent molecular methods

نویسندگان English

Nafiseh Davati 1
Shohreh Hesami 2
1 Department of Food Science and Technology, Bu-Ali Sina University. Hamedan, Iran.
2 Department of Biology, Faculty of Science, Bu-Ali Sina University. Hamedan, Iran.
چکیده English

Introduction: Nowadays, More people are interested in consuming organic products. Many of the organic foods and dairy products are produced by rural people and nomads in Iran. Some people are concerned about using of the contaminated organic foods with pathogenic microorganisms, because some of these organic foods are produced under poor hygienic conditions. On the other hand, many native strains of probiotic bacteria especially lactic acid bacteria can be found in these organic foods. In this study, the microbial community and sanitary quality of ewe’s drinking yogurt produced by Somar region nomads, by using culture dependent molecular method and next-generation sequencing (NGS), as a new tool for the culture independent molecular characterization of bacteria, were assessed.

Materials and methods: A total of three Ewe's drinking yogurt samples were collected from the nomads of Somar region in Iran under sterile conditions. For phenotypic identification of lactic acid bacteria, a volume of 0.1 milliliters of appropriate dilutions was cultured on MRS agar and M17 agar media. The plates were incubated at 37oC under anaerobic condition with Anaerocult® A for 48 hours. Typical LAB characteristics colonies were purified by streaking method on MRS agar and M17 agar. The catalase negative and Gram positive isolates were selected as presumptive lactic acid bacteria for phenotypic identification to the genus level. These isolated bacteria were tested for growth at 100C and 450C in MRS and M17 broth, gas production from glucose, growth in the presence of 6.5% and 18% of NaCl, growth at pH 4.4 and pH 9.6 and arginine hydrolysis. Isolates were identified by amplification of the 16S ribosomal RNA gene by Polymerase Chain Reaction and ribosomal DNA sequencing as a culture dependent molecular method. After DNA extraction of isolates, PCR was performed using prokaryotic 16S rDNA universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3). In the next step, the culture-independent molecular method based on next-generation sequencing of 16S ribosomal RNA gene amplicons was applied. The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locus‐specific sequences were: Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐ [locus- specific sequence] Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed. The fastq files from the next generation sequencing were analyzed with BaseSpace (cloud‐based software, MSR: Metagenomics, version: 2.4.60.8). This metagenomics analysis classified organisms from V3 and V4 amplicon using a database of 16S rRNA data and performed a taxonomic classification using the Greengenes database showing species level classification in a graphical format (http://greengenes.lbl.gov/). The analysis output was a classification of reads at several taxonomic levels: kingdom, phylum, class, order, family, genus, and species. The analysis results included tables, cluster pie charts, phylogenetic trees and bar charts. The average and error bars of the relative abundance (%) of bacterial species from ewe’s milk and yogurt were calculated using Microsoft Excel 2010 software.

Results & Discussion: A total of 40 bacteria as lactic acid bacteria were isolated from ewe’s drinking yogurt. Among isolated bacteria, two different genus of lactic acid bacteria were phenotypically characterized as 88% Lactobacillus, 3.5% Pediococcus and 8.5% Non-lactic acid bacteria. Isolates were identified by ribosomal DNA sequencing as Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus.
The microbial community from ewe’s drinking yogurt were identified on the basis of Next-generation sequencing (NGS) at genus level as 94.08% Lactobacillus, 1.07% Pediococcus, 0.33% Streptococcus, 0.20% Enterococcus, 0.11% Candidatus Blochmannia, 0.11% Alkalibacillus, 0.06% Cohnella and 3.02% unclassified. At species level 24.82% Lactobacillus equicursoris, 51.81% Lactobacillus delbrueckii, 3.61% Lactobacillus apis, 2.79% Lactobacillus ultunensis, 0.86% Lactobacillus taiwanensis, 0.85% Lactobacillus gigeriorum, 0.42% Pediococcus argentinicus and 13.64% unclassified were identified. Findings of this study have provided fundamental knowledge on sanitary quality and microbial composition of drinking yogurt produced by Somar nomads. Both phenotypic and molecular identification methods showed Pediococcus and Lactobacillus genus as the dominant genera in these samples. Molecular identification results showed Lactobacillus delbrueckii as the dominant species. Four species, Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus were identified by both cultivation-dependent and cultivation-independent (NGS) methods. Rather, culture-dependent and culture-independent methods were found to be complementary in describing the microbial community of the ewe’s drinking yogurt produced by Somar nomads. The next-generation sequencing was found to be more accurate method in detecting the microbial diversity of drinking yogurt. The results showed poor hygienic quality of ewe’s drinking yogurt from Somar nomads, but there were no pathogenic bacteria in this product.

کلیدواژه‌ها English

Next-Generation Sequencing
Drinking Yogurt
Ewe
nomds
طباطبایی، م. و پورمظاهری، ه.، 1391، متاژنومیکس و کاربرد آن در شناسایی تنوع ژنتیکی اکوسیستم های میکروبی. فصلنامه ژنتیک نوین، 7 (4)، 313-324.
Alegria, Á., Álvarez-Martin, P., Sacristan, N., Fernandez, E., Delgado, S. & Mayo, B., 2009. Diversity and evolution of the microbial populations during manufacture and ripening of Casin, a traditional Spanish, starter-free cheese made from cow's milk. International journal of food microbiology, 136(1), 44-51.
Ashmaig, A., Hasan, A. & Gaali El, E., 2009. Identification of lactic acid bacteria isolated from traditional Sudanese fermented camel’s milk (Gariss). African Journal of Microbiology Research, 3(8), 451-457.
Asmahan Azhari, A., 2011. Isolation and Identification of Lactic Acid Bacteria Isolated from Traditional Drinking Yoghurt in Khartoum State, Sudan. Current Research in Bacteriology, 4, 16-22.
Azadnia, P. & Khan Nazer, A. H., 2009. Identification of lactic acid bacteria isolated from traditional drinking yoghurt in tribes of Fars province. Iranian Journal of Veterinary Research, 10 (3), 235-240.
Benson Harold, J., 1967. Microbiological applications; a laboratory manual in general microbiology.
Cardinal. M. J., Meghrous, J., Lacroix, C. and Simard, R. E., 1997. Isolation of Lactococcus Lactis Strains Producing Inhibitory Activity against Listeria. Food Biotechnology. 11(2), 129-46.
Cho, E.A., Lee, J.S., Lee, K.C., Jung, H.C., Pan, J.G. & Pyun, Y.R., 2007. Cohnella laeviribosi sp. nov., isolated from a volcanic pond. International journal of systematic and evolutionary microbiology, 57(12), 2902-2907.
De Bruyne, K., Franz, C., Vancanneyt, M., Schillinger, U., Mozzi, F., de Valdez, G. F., De Vuyst, L & Vandamme, P., 2008. Pediococcus argentinicus sp. nov. from Argentinean fermented wheat flour and identification of Pediococcus species by pheS, rpoA and atpA sequence analysis. International journal of systematic and evolutionary microbiology, 58, 2909-2916.
Feldhaar, H., Straka, J., Berthold, K., Krischke, M., Mueller, M.J., Gross, R. & Stoll, S., 2007. Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia. BMC biology, 5(1), 48.
Garcia-Fraile, P., Velazquez, E., Mateos, P.F., Martinez-Molina, E. & Rivas, R., 2008. Cohnella phaseoli sp. nov., isolated from root nodules of Phaseolus coccineus in Spain, and emended description of the genus Cohnella. International journal of systematic and evolutionary microbiology, 58(8),1855-1859.
Goldstein, E. J., Tyrrell, K. L. & Citron, D. M., 2015. Lactobacillus Species: Taxonomic Complexity and Controversial Susceptibilities. Clinical Infectious Diseases, 60 (2), S98-S107.
Gulat-Okalla, M. L., Motreff, L., Gouyette, C., Bouchier, C., Clermont, D. & Bizet, C., 2012. Lactobacillus gigeriorum sp. nov., isolated from chicken crop Sylvie Cousin. International Journal of Systematic and Evolutionary Microbiology, 62, 330–334.
Harrigan, W., 1998. Laboratory methods in food microbiology: Gulf Professional Publishing.
Khedid, K., Faid, M., Mokhtari, A., Soulaymani, A. & Zinedine, A., 2009. Characterization of lactic acid bacteria isolated from the one humped camel milk produced in Morocco. Microbiological research, 164(1), 81-91.
Killer, J., Dubna, S., Sedlacek ,I. & Švec, P., 2014. Lactobacillus apis sp. nov., from the stomach of honeybees (Apis mellifera), having an in vitro inhibitory effect on the causative agents of American and European foulbrood. International Journal of Systematic and Evolutionary Microbiology, 64, 152–157.
Mohania, D., Nagpal, R., Kumar, M., Bhardwaj, A., Yadav, M., Jain, S., Marotta, F., Singh, V., Parkash, O. & Yadav, H., 2008. Molecular approaches for identification and characterization of lactic acid bacteria. Journal of digestive Diseases, 9(4), 190-198.
Moraes, P. M., Perin, L. M., Silva, J. A. & Nero, L. A., 2013. Comparison of phenotypic and molecular tests to identify lactic acid bacteria. Brazilian Journal of Microbiology, 44(1), 109-12.
Morita, H., Shimazu, M., Shiono, H. & Hattori, M., 2010. Lactobacillus equicursoris sp. nov., isolated from the faeces of a thoroughbred racehorse. International journal of systematic and evolutionary microbiology, 60(1), 109-12.
Ouadghiri, M., Amar, M., Vancanneyt, M. & Swings, J., 2005. Biodiversity of lactic acid bacteria in Moroccan soft white cheese (Jben). FEMS microbiology letters, 251(2), 267-271.
Romano, I., Lama, L., Nicolaus, B., Gambacorta, A. & Giordano, A., 2005. Alkalibacillus filiformis sp. nov., isolated from a mineral pool in Campania, Italy. International journal of systematic and evolutionary microbiology, 55(6), 2395-2399.
Roos, S., Engstrand, L. & Jonsson, H., 2005. Lactobacillus gastricus sp. nov., Lactobacillus antri sp. nov., Lactobacillus kalixensis sp. nov. and Lactobacillus ultunensis sp. nov., isolated from human stomach mucosa. International journal of systematic and evolutionary microbiology, 55(1), 77-82.
Ruiz-Barba, J.L., Maldonado, A. & Jimenez-Diaz, R., 2005. Small-scale total DNA extraction from bacteria and yeast for PCR applications. Analytical biochemistry, 347(2), 333-335.
Salminen, S. & Von Wright, A. eds., 2004. Lactic acid bacteria: microbiological and functional aspects. CRC Press. Marcel Dekker, 139, 73-103.
Usami, R., Echigo, A., Fukushima, T., Mizuki, T., Yoshida, Y. & Kamekura, M., 2007. Alkalibacillus silvisoli sp. nov., an alkaliphilic moderate halophile isolated from non-saline forest soil in Japan. International journal of systematic and evolutionary microbiology, 57(4), 770-774.
Wang, L.T., Kuo, H.P., Wu, Y.C., Tai, C.J. & Lee, F.L., 2009. Lactobacillus taiwanensis sp. nov., isolated from silage. International journal of systematic and evolutionary microbiology, 59(8), 2064-2068.
ارسال نظر در مورد این مقاله
نام را وارد کنید.
نشانی پست الکترونیکی را به درستی وارد کنید.
وابستگی سازمانی را به درستی وارد کنید.
توضیحات را وارد کنید (حداقل 50 حرف)
CAPTCHA Image
شناسه امنیتی را به درستی وارد کنید.
دوره 14، شماره 5 - شماره پیاپی 53
آذر و دی 1397
صفحه 685-698

  • تاریخ دریافت 20 آذر 1396
  • تاریخ بازنگری 02 بهمن 1396
  • تاریخ پذیرش 20 فروردین 1397
  • تاریخ اولین انتشار 01 آذر 1397