با همکاری انجمن علوم و صنایع غذایی ایران

تشخیص اختصاصی آفلاتوکسین G1 بر مبنای رنگ‌سنجی آپتاسنسور به‌وسیله سوسپانسیون نانو ذرات طلا شده

نوع مقاله : مقاله پژوهشی

نویسندگان

گروه علوم وصنایع غذایی، واحد قوچان، دانشگاه آزاد اسلامی، قوچان، ایران.

چکیده
آفلاتوکسین‌ها سموم قارچی طبیعی هستند که از گونه‌های قارچ آسپرژیلوس مانند آسپرژیلوس فلاووس و آسپرژیلوس پارازیتیکوس نشات می‌گیرند. این سموم اگر از راه مواد خوراکی وارد بدن شوند می‌توانند سرطان‌زا باشند. روش­های تشخیصی متفاوتی برای آفلاتوکسین وجود دارد که زمان­بر و پرهزینه می‌باشد. روش آپتاسنسورهای رنگ‌سنجی به‌وسیله نانو ذرات طلای سوسپانسیون شده در آب، روشی سریع و اختصاصی می‌باشد که با استفاده از یک ملکول شناساگر با درجه انتخابی بالا انجام می‌شود. در این پژوهش آپتامری با توالی GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA برای تشخیص چهار آفلاتوکیسن B1، B2، G1 و G2 استفاده شد. نتایج نشان داد که این آپتامر به‌طور اختصاصی توانایی تشخیص آفلاتوکیسن G1 را داشت به نحوی که هنگام اضافه شدن آفلاتوکسین G1 به محلول حاوی آپتامر و نانوذرات طلا ، آپتامر دچار تغییر ساختار شده و از نانو ذرات طلا جدا می‌شود و جذب آفلاتوکسین می‌گردد. پس از جدا شدن آپتامر، نانوذرات ناپایدار شده بلافاصله تجمع و رسوب داده که منجر به تغییر رنگ از قرمز به بنفش می‌گردند. اما در مورد سایر آفلاتوکسین های مورد بررسی چنین تغییر رنگی مشاهده نشد که نشان‌دهنده آن است که این آپتامر در برابر آن‌ها به تغییر ساختار حساس نیست و اختصاصی عمل نمی‌کند.

کلیدواژه‌ها


عنوان مقاله English

Proprietary diagnosis of aflatoxin G1 based on aptasensor colorimetry using gold nanoparticles Suspension

نویسندگان English

Arezoo Hashemnia
Vahid Hakimzadeh
Department of food science and technology, Quchan Branch, Islamic Azad University, Quchan, Iran.
چکیده English

Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields which, when they interact with electromagnetic resonance radiation, their radiant properties rises sharply. This process causes the absorption process of these nanoparticles to be several times stronger than the absorption process of the strongest adsorbent molecules and their scattered light is several times more intense than the organic materials fluorescence. These unique properties provide a high potential for these nanoparticles to be used in many applications such as biochemical sensors, biomedical imaging and medical treatments. Aptamers are single-stranded oligonucleotides, DNA, RNA or proprietary proteins that have the ability to attach specifically to their target. The basis for identifying the target by aptamers is the third structure formed by them. One of the important benefits of aptamers to antibodies is their smaller size, which makes them more easily and effectively penetrated. It also has neither toxicity nor immunogenicity unless in very low levels. Therefore, biosensors that use aptamers as biological identifiers are known as aptasensors. In this research, due to the high losses caused by aflatoxins to the crops and their toxicity, the rapid detection of these pesticides by aptasensor method was investigated.
 
Materials and methods: The test was carried out in a 96-well plate and for each concentration three replicates were considered. In each test, 100 μl of the nano gold solution, which was centrifuged twice at 12000 rpm and at room temperature, was thrown into 11 concentrations and three repetitions in the plate houses. Then adding 15 μlit of aptamer at a concentration of 5 μmol plus 10 μlit of distilled ultrapure water to the houses and incubate for 30 minutes at room temperature. After this time, 25 μlit of different concentrations of aflatoxin plus 15 μlit of 2 molar salt solutions and 35 μlit of distilled water were added to the houses and, after mixing (up and down) in the ELISA reader, absorbed it we read.
 
Results and discussions: At first, with adding the aptamer to Nano gold particles a complex between nanoparticles and aptamer is created. But in present of suitable aflatoxin, the complex of nanoparticle and aptamer is separated and a new complex between aflatoxin and nanoparticle is formed. Subsequently the color is changed to purple. This color change is visible to the eye, indicating that the Aptamer is suitable for Target. In this study, it was found that an aptamer with GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA sequence only affects aflatoxin G1 and other aflatoxins such as B1, B2, and G2 should be considered as another sequencer for Aptamer.

کلیدواژه‌ها English

Aptamar
Aflatoxin
Biosensors
Gold Nanoparticles
Suspensions
Akbari, B Pirhadi Tavandashti, A and Zandrahimi, M. 2011. Particle Size Characterization of Nanoparticles- a Practical Application”, Iranian Journal of Materials Science & Engineering, 8 (2): 48-56.
Alex P. Wacoo, Deborah Wendiro, Peter C. Vuzi, and Joseph F. Hawumba. 2014. Methods for Detection of Aflatoxins in Agricultural Food Crops. Journal of Applied Chemistry Volume 2014, Article ID 706291, 1-15
Amini A., Afzali-Grooh D., Chamsaz M. 2014. Determination of Aflatoxins B1 and B2 in Powdered Milk Using Modified Liquid Chromatography Method, 21 (4): 321-331.
Blank M, Blind M. 2005. Aptamers as tools for target validation. Current Opinion in Chemical Biology. 9(4):336-42.
Chen A, Liu J, Guan Z, LV Z, Jiang X, Yang S. 2014. Improving sensitivity of gold nanoparticle based fluorescence quenching and colorimetric aptasensor by using water resuspended gold nanoparticle. Biosensors and Bioelectronics 52 (15), 265-270.
Davis KA, Abrams B, Lin Y, Jayasena SD. 1996. Use of a high affinity DNA ligand in flow cytometry. Nucleic Acids Research. 24(4):702-6.
El-Sayed M.A. 2001. Some Interesting Properties of Metals Confined in Time and Nanometer Space of Different Shapes. Acc. Chem. Res., 34 (4), pp 257–264.
Freund, P. L., Spiro, M. (1986). J. Chem. Soc., Faraday Trans. 1, 82, 2277.
Gopinath SCB. 2007. Methods developed for SELEX. Analytical and Bioanalytical Chemistry.387(1):171-82.
Hermann T, Patel DJ. 2000. Adaptive recognition by nucleic acid aptamers. Science. ;287(5454):820
Hicke BJ, Stephens AW, Gould T, Chang Y-F, Lynott CK, Heil J, et al. 2006. Tumor Targeting by an Aptamer. J Nucl Med. 2006 1, 47(4):668-78.
Hirsch, L. R., Stafford, R. J., Bankson, J. A., Sershen, S. R., Rivera, B., Rrice, R. E., Hazle, J. D., Halas, N. J. West, J. L. 2003. Nanoshell-mediated near-infrared thermal therapy of tumors under magnetic resonance guidance. Proc. Natl. Acad. Sci, 100(23):13549-54.
Link S and El-Sayed M.A. 1999. Spectral Properties and Relaxation Dynamics of Surface Plasmon Electronic Oscillations in Gold and Silver Nanodots and Nanorods. J. Phys. Chem. B 103, 8410-8426.
Mirkin CA, Letsinger RL, Mucic RC, Storhoff JJ. 1996. A DNA-based method for rationally assembling nanoparticles into macroscopic material. J. Nature, 382(6592):607-9.
Ohuchi SP, Ohtsu T, Nakamura Y. 2006. Selection of RNA aptamers against recombinant transforming growth factor-[beta] type III receptor displayed on cell surface. Biochimie. 88(7): 897-904.
Pan, Y et al, 2007. Size-dependent cytotoxicity of gold nanoparticles. Small, 3 (11): 1941-1949.
Que-Gewirth NS, Sullenger BA. 2007. Gene therapy progress and prospects: RNA aptamers. Gene Therapy, 14(4):283-91.
Shankar, S.S, Rai, A, Ahmad, A. Sastry, M. 2004. Rapid synthesis of Au, Ag and bimetallic Au core-Ag shell nanoparticle using neem (Azadirachtaindica) leaf broth”,Colloid Interface Sci, 2004,275,496-502.
Stoltenburg R, Reinemann C, Strehlitz B. 2007. SELEX--a (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol Eng. [Review]. 24(4):381-403.
Susie Eustis. 2006. Gold and Silver Nanoparticles: Characterization of Their Interesting Optical Properties and the Mechanism of Their Photochemical Formation. thesis for the DegreeDoctor. Georgia Institute of Technology.
Thakur M.S, Shwetha N, Selvakumar L.S. 2013. Aptamer–nanoparticle-based chem luminescence for p53 p Anal. Biochem, 262(2):137-56.
Yguerabide J, Yguerabide E 1998. Light-scattering submicroscopic particles as highly fluorescent analogs and their use as tracer labels in clinical and biological applications. Anal. Biochem, 262(2):137-56.
Zhou L, Wang MH, Wang JP, Ye ZZ. 2011. Application of Biosensor Surface Immobilization Methods for Aptamer. Chinese Journal of Analytical Chemistry. 39(3):432-8.
ارسال نظر در مورد این مقاله
نام را وارد کنید.
نشانی پست الکترونیکی را به درستی وارد کنید.
وابستگی سازمانی را به درستی وارد کنید.
توضیحات را وارد کنید (حداقل 50 حرف)
CAPTCHA Image
شناسه امنیتی را به درستی وارد کنید.
دوره 15، شماره 4 - شماره پیاپی 58
مهر و آبان 1398
صفحه 433-439

  • تاریخ دریافت 21 بهمن 1396
  • تاریخ بازنگری 10 بهمن 1397
  • تاریخ پذیرش 17 فروردین 1398
  • تاریخ اولین انتشار 01 مهر 1398